EMAIL THIS PAGE TO A FRIEND

HCFC1

host cell factor C1 (VP16-accessory protein)

Synonyms: CFF HCF-1 HCF1 HFC1 MRX3 VCAF
UniProtKB ID: P51610, Q6P4G5
Gene ID:
Human(3054) Summary: This gene is a member of the host cell factor family and encodes a protein with five Kelch repeats, a fibronectin-like motif, and six HCF repeats, each of which contains a highly specific cleavage signal. This nuclear coactivator is proteolytically cleaved at one of the six possible sites, resulting in the creation of an N-terminal chain and the corresponding C-terminal chain. The final form of this protein consists of noncovalently bound N- and C-terminal chains. The protein is involved in control of the cell cycle and transcriptional regulation during herpes simplex virus infection. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
Mouse(15161) host cell factor C1
Rat(363519) host cell factor C1
domestic cat(101089996) host cell factor C1 (VP16-accessory protein)
Horse(100058080) host cell factor C1 (VP16-accessory protein)
cow(512908) host cell factor C1 (VP16-accessory protein)
dog(492246) host cell factor C1 (VP16-accessory protein)
domestic guinea pig(100735420) host cell factor C1 (VP16-accessory protein)
naked mole-rat(101697902) host cell factor C1 (VP16-accessory protein)
Domestic Rabbit(100328750) host cell factor C1 (VP16-accessory protein)
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38600 Anti-HCFC1 antibody produced in rabbit IgG fraction of antiserum guinea pig, bovine, canine, human, mouse, horse, zebrafish, rabbit, rat, rabbit
western blot pricing
HPA018312 Anti-HCFC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2104420 Anti-HCFC1 antibody produced in rabbit affinity isolated antibody bovine, canine, horse, rabbit, rat, guinea pig, human, mouse, rabbit
western blot pricing
SAB4501378 Anti-HCFC1, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry pricing
PLA0188 Rabbit anti-HCF1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. dog, mouse, horse, human, rhesus monkey, chimpanzee, marmoset, gorilla, primate
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008224 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008224 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008224 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005334 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005334 Rosetta Predictions human pricing
XM_001057067 Rosetta Predictions rat pricing
XM_343843 Rosetta Predictions rat pricing
NM_008224 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339401 predicted 6596
2 SASI_Hs01_00053487 predicted 6064
3 SASI_Hs01_00053488 predicted 843
4 SASI_Hs01_00053489 predicted 5261
5 SASI_Hs01_00053490 predicted 4828
6 SASI_Hs01_00053492 predicted 1039
7 SASI_Hs01_00053493 predicted 2427
8 SASI_Hs01_00053494 predicted 2413
9 SASI_Hs01_00053495 predicted 893
10 SASI_Hs02_00339402 predicted 2000
11 SASI_Hs01_00053491 predicted 5967
12 SASI_Hs01_00053496 predicted 5990
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057067 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285296 predicted 1713
2 SASI_Rn02_00285297 predicted 1398
3 SASI_Rn02_00285298 predicted 6911
4 SASI_Rn02_00285299 predicted 6751
5 SASI_Rn02_00285300 predicted 2033
6 SASI_Rn02_00285301 predicted 1370
7 SASI_Rn02_00285302 predicted 7266
8 SASI_Rn02_00285303 predicted 2575
9 SASI_Rn02_00285304 predicted 5702
10 SASI_Rn02_00285305 predicted 4321
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396437 predicted 1714
2 SASI_Rn02_00396438 predicted 1401
3 SASI_Rn02_00396439 predicted 6777
4 SASI_Rn02_00396440 predicted 6611
5 SASI_Rn02_00396441 predicted 2027
6 SASI_Rn02_00396442 predicted 1373
7 SASI_Rn02_00396443 predicted 7124
8 SASI_Rn02_00396444 predicted 2578
9 SASI_Rn02_00396445 predicted 2435
10 SASI_Rn02_00396446 predicted 4316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008224 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051349 predicted 3443
2 SASI_Mm01_00051350 predicted 1225
3 SASI_Mm01_00051351 predicted 5801
4 SASI_Mm01_00051352 predicted 3137
5 SASI_Mm02_00313413 predicted 594
6 SASI_Mm01_00051354 predicted 3510
7 SASI_Mm01_00051355 predicted 1628
8 SASI_Mm01_00051356 predicted 2617
9 SASI_Mm01_00051357 predicted 818
10 SASI_Mm01_00051358 predicted 2190
11 SASI_Mm01_00051353 predicted 2218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008224
VALIDATED
HCFC1 MISSION shRNA Bacterial Glycerol Stock
host cell factor C1 (VP16-accessory protein)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008224.2-7043s1c1
Sequence:CCGGGCCTTTGAGTTCCCACTCAATCTCGAGATTGAGTGGGAACTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008224.2-1297s1c1
Sequence:CCGGGCCATCAATACTCGTCTGTATCTCGAGATACAGACGAGTATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008224.2-2202s1c1
Sequence:CCGGCCCTATCATCACAGTACACAACTCGAGTTGTGTACTGTGATGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008224.2-1298s1c1
Sequence:CCGGCCATCAATACTCGTCTGTATACTCGAGTATACAGACGAGTATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008224.2-5877s1c1
Sequence:CCGGCCCAGACTATAACCAGCTAAACTCGAGTTTAGCTGGTTATAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008224.3-2625s21c1
Sequence:CCGGCATTCCTATGTCGGCCATTATCTCGAGATAATGGCCGACATAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008224.3-2600s21c1
Sequence:CCGGCTGGCACAACTACCATTATTACTCGAGTAATAATGGTAGTTGTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008224.3-6778s21c1
Sequence:CCGGGGAGATAACACCCATACTTAACTCGAGTTAAGTATGGGTGTTATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008224.3-6242s21c1
Sequence:CCGGCCAACGCCCACATTGACTATACTCGAGTATAGTCAATGTGGGCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008224.3-428s21c1
Sequence:CCGGTGGCTATCAAGGAGCTTATAGCTCGAGCTATAAGCTCCTTGATAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008224
VALIDATED
HCFC1 MISSION shRNA shRNA Plasmid DNA
host cell factor C1 (VP16-accessory protein)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008224.2-7043s1c1
Sequence:CCGGGCCTTTGAGTTCCCACTCAATCTCGAGATTGAGTGGGAACTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008224.2-1297s1c1
Sequence:CCGGGCCATCAATACTCGTCTGTATCTCGAGATACAGACGAGTATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008224.2-2202s1c1
Sequence:CCGGCCCTATCATCACAGTACACAACTCGAGTTGTGTACTGTGATGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008224.2-1298s1c1
Sequence:CCGGCCATCAATACTCGTCTGTATACTCGAGTATACAGACGAGTATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008224.2-5877s1c1
Sequence:CCGGCCCAGACTATAACCAGCTAAACTCGAGTTTAGCTGGTTATAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008224.3-2625s21c1
Sequence:CCGGCATTCCTATGTCGGCCATTATCTCGAGATAATGGCCGACATAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008224.3-2600s21c1
Sequence:CCGGCTGGCACAACTACCATTATTACTCGAGTAATAATGGTAGTTGTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008224.3-6778s21c1
Sequence:CCGGGGAGATAACACCCATACTTAACTCGAGTTAAGTATGGGTGTTATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008224.3-6242s21c1
Sequence:CCGGCCAACGCCCACATTGACTATACTCGAGTATAGTCAATGTGGGCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008224.3-428s21c1
Sequence:CCGGTGGCTATCAAGGAGCTTATAGCTCGAGCTATAAGCTCCTTGATAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008224
VALIDATED
HCFC1 MISSION shRNA Lentiviral Transduction Particles
host cell factor C1 (VP16-accessory protein)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008224.2-7043s1c1
Sequence:CCGGGCCTTTGAGTTCCCACTCAATCTCGAGATTGAGTGGGAACTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008224.2-1297s1c1
Sequence:CCGGGCCATCAATACTCGTCTGTATCTCGAGATACAGACGAGTATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008224.2-2202s1c1
Sequence:CCGGCCCTATCATCACAGTACACAACTCGAGTTGTGTACTGTGATGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008224.2-1298s1c1
Sequence:CCGGCCATCAATACTCGTCTGTATACTCGAGTATACAGACGAGTATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008224.2-5877s1c1
Sequence:CCGGCCCAGACTATAACCAGCTAAACTCGAGTTTAGCTGGTTATAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008224.3-2625s21c1
Sequence:CCGGCATTCCTATGTCGGCCATTATCTCGAGATAATGGCCGACATAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008224.3-2600s21c1
Sequence:CCGGCTGGCACAACTACCATTATTACTCGAGTAATAATGGTAGTTGTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008224.3-6778s21c1
Sequence:CCGGGGAGATAACACCCATACTTAACTCGAGTTAAGTATGGGTGTTATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008224.3-6242s21c1
Sequence:CCGGCCAACGCCCACATTGACTATACTCGAGTATAGTCAATGTGGGCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008224.3-428s21c1
Sequence:CCGGTGGCTATCAAGGAGCTTATAGCTCGAGCTATAAGCTCCTTGATAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005334
VALIDATED
HCFC1 MISSION shRNA Bacterial Glycerol Stock
host cell factor C1 (VP16-accessory protein)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005334.1-6052s1c1
Sequence:CCGGCCTTTCTCTTTCTCTCTGTTTCTCGAGAAACAGAGAGAAAGAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005334.1-585s1c1
Sequence:CCGGGCAACCACCATCGGAAATAAACTCGAGTTTATTTCCGATGGTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005334.1-1703s1c1
Sequence:CCGGCCCTATCATCACAGTGCACAACTCGAGTTGTGCACTGTGATGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005334.1-5892s1c1
Sequence:CCGGCCAAAGAAATCTAAGGCCGATCTCGAGATCGGCCTTAGATTTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005334.1-5766s1c1
Sequence:CCGGGCCCGCAATGAGAAGGGCTATCTCGAGATAGCCCTTCTCATTGCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005334.2-6033s21c1
Sequence:CCGGTGTCCCATCAGACGATGATTTCTCGAGAAATCATCGTCTGATGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005334.2-6481s21c1
Sequence:CCGGGCCCGCAATGAGAAGGGCTATCTCGAGATAGCCCTTCTCATTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005334.2-7095s21c1
Sequence:CCGGGTGTTTCCAGTCACCTAACTTCTCGAGAAGTTAGGTGACTGGAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005334.2-5995s21c1
Sequence:CCGGGTAATGGTGACACACTATTTCCTCGAGGAAATAGTGTGTCACCATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005334
VALIDATED
HCFC1 MISSION shRNA shRNA Plasmid DNA
host cell factor C1 (VP16-accessory protein)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005334.1-6052s1c1
Sequence:CCGGCCTTTCTCTTTCTCTCTGTTTCTCGAGAAACAGAGAGAAAGAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005334.1-585s1c1
Sequence:CCGGGCAACCACCATCGGAAATAAACTCGAGTTTATTTCCGATGGTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005334.1-1703s1c1
Sequence:CCGGCCCTATCATCACAGTGCACAACTCGAGTTGTGCACTGTGATGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005334.1-5892s1c1
Sequence:CCGGCCAAAGAAATCTAAGGCCGATCTCGAGATCGGCCTTAGATTTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005334.1-5766s1c1
Sequence:CCGGGCCCGCAATGAGAAGGGCTATCTCGAGATAGCCCTTCTCATTGCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005334.2-6033s21c1
Sequence:CCGGTGTCCCATCAGACGATGATTTCTCGAGAAATCATCGTCTGATGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005334.2-6481s21c1
Sequence:CCGGGCCCGCAATGAGAAGGGCTATCTCGAGATAGCCCTTCTCATTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005334.2-7095s21c1
Sequence:CCGGGTGTTTCCAGTCACCTAACTTCTCGAGAAGTTAGGTGACTGGAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005334.2-5995s21c1
Sequence:CCGGGTAATGGTGACACACTATTTCCTCGAGGAAATAGTGTGTCACCATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005334
VALIDATED
HCFC1 MISSION shRNA Lentiviral Transduction Particles
host cell factor C1 (VP16-accessory protein)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005334.1-6052s1c1
Sequence:CCGGCCTTTCTCTTTCTCTCTGTTTCTCGAGAAACAGAGAGAAAGAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005334.1-585s1c1
Sequence:CCGGGCAACCACCATCGGAAATAAACTCGAGTTTATTTCCGATGGTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005334.1-1703s1c1
Sequence:CCGGCCCTATCATCACAGTGCACAACTCGAGTTGTGCACTGTGATGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005334.1-5892s1c1
Sequence:CCGGCCAAAGAAATCTAAGGCCGATCTCGAGATCGGCCTTAGATTTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005334.1-5766s1c1
Sequence:CCGGGCCCGCAATGAGAAGGGCTATCTCGAGATAGCCCTTCTCATTGCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005334.2-6033s21c1
Sequence:CCGGTGTCCCATCAGACGATGATTTCTCGAGAAATCATCGTCTGATGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005334.2-6481s21c1
Sequence:CCGGGCCCGCAATGAGAAGGGCTATCTCGAGATAGCCCTTCTCATTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005334.2-7095s21c1
Sequence:CCGGGTGTTTCCAGTCACCTAACTTCTCGAGAAGTTAGGTGACTGGAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005334.2-5995s21c1
Sequence:CCGGGTAATGGTGACACACTATTTCCTCGAGGAAATAGTGTGTCACCATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks