EMAIL THIS PAGE TO A FRIEND

HCFC1R1

host cell factor C1 regulator 1 (XPO1 dependent)

Synonyms: HPIP
UniProtKB ID: Q9NWW0, D3DUA7, Q68EN7
Gene ID:
Mouse(353502) host cell factor C1 regulator 1 (XPO1-dependent)
Rat(287097) host cell factor C1 regulator 1 (XPO1-dependent)
domestic cat(101100022) host cell factor C1 regulator 1 (XPO1 dependent)
cow(535210) host cell factor C1 regulator 1 (XPO1 dependent)
dog(610727) host cell factor C1 regulator 1 (XPO1 dependent)
Goat(100861053) host cell factor C1 regulator 1 (XPO1 dependent)
sheep(101120043) host cell factor C1 regulator 1 (XPO1 dependent)
domestic guinea pig(100714802) host cell factor C1 regulator 1 (XPO1 dependent)
naked mole-rat(101724868) host cell factor C1 regulator 1 (XPO1 dependent)
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181821 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181821 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181821 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001002017 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002017 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002017 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002017 Rosetta Predictions human pricing
NM_001002018 Rosetta Predictions human pricing
NM_017885 Rosetta Predictions human pricing
XM_001055621 Rosetta Predictions rat pricing
XM_573052 Rosetta Predictions rat pricing
NM_181821 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094488 predicted 794
2 SASI_Hs01_00094493 predicted 835
3 SASI_Hs01_00094494 predicted 450
4 SASI_Hs01_00094495 predicted 775
5 SASI_Hs01_00094496 predicted 589
6 SASI_Hs01_00094497 predicted 833
7 SASI_Hs02_00304074 predicted 771
8 SASI_Hs02_00304075 predicted 750
9 SASI_Hs02_00304076 predicted 595
10 SASI_Hs01_00094489 predicted 578
11 SASI_Hs01_00094490 predicted 463
12 SASI_Hs01_00094491 predicted 453
13 SASI_Hs01_00094492 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045034 predicted 645
2 SASI_Hs01_00045038 predicted 684
3 SASI_Hs01_00045039 predicted 288
4 SASI_Hs01_00045040 predicted 613
5 SASI_Hs01_00045041 predicted 436
6 SASI_Hs01_00045042 predicted 679
7 SASI_Hs01_00045043 predicted 240
8 SASI_Hs02_00304077 predicted 612
9 SASI_Hs02_00304078 predicted 590
10 SASI_Hs02_00304079 predicted 442
11 SASI_Hs01_00045035 predicted 427
12 SASI_Hs01_00045036 predicted 301
13 SASI_Hs01_00045037 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191516 predicted 857
2 SASI_Hs01_00191520 predicted 892
3 SASI_Hs01_00191521 predicted 503
4 SASI_Hs01_00191522 predicted 831
5 SASI_Hs01_00191523 predicted 655
6 SASI_Hs01_00191524 predicted 890
7 SASI_Hs01_00191525 predicted 454
8 SASI_Hs02_00350832 predicted 826
9 SASI_Hs02_00350833 predicted 807
10 SASI_Hs02_00350834 predicted 654
11 SASI_Hs01_00191517 predicted 638
12 SASI_Hs01_00191518 predicted 509
13 SASI_Hs01_00191519 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280372 predicted 359
2 SASI_Rn02_00280373 predicted 448
3 SASI_Rn02_00280374 predicted 218
4 SASI_Rn02_00280375 predicted 335
5 SASI_Rn02_00280376 predicted 236
6 SASI_Rn02_00280377 predicted 295
7 SASI_Rn02_00280378 predicted 450
8 SASI_Rn02_00280379 predicted 246
9 SASI_Rn02_00280380 predicted 377
10 SASI_Rn02_00280381 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573052 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399696 predicted 355
2 SASI_Rn02_00399697 predicted 446
3 SASI_Rn02_00399698 predicted 219
4 SASI_Rn02_00399699 predicted 340
5 SASI_Rn02_00399700 predicted 235
6 SASI_Rn02_00399701 predicted 298
7 SASI_Rn02_00399702 predicted 441
8 SASI_Rn02_00399703 predicted 244
9 SASI_Rn02_00399704 predicted 231
10 SASI_Rn02_00399705 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181821 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155717 predicted 932
2 SASI_Mm01_00155718 predicted 834
3 SASI_Mm01_00155719 predicted 755
4 SASI_Mm01_00155720 predicted 779
5 SASI_Mm01_00155721 predicted 752
6 SASI_Mm01_00155722 predicted 443
7 SASI_Mm01_00155723 predicted 928
8 SASI_Mm01_00155724 predicted 613
9 SASI_Mm01_00155725 predicted 754
10 SASI_Mm01_00155726 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181821
VALIDATED
HCFC1R1 MISSION shRNA Bacterial Glycerol Stock
host cell factor C1 regulator 1 (XPO1 dependent)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181821.1-532s21c1
Sequence:CCGGCTCAGCCTACATAATGACCACCTCGAGGTGGTCATTATGTAGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181821.1-506s21c1
Sequence:CCGGAGAACATGGCCACCCATTTCTCTCGAGAGAAATGGGTGGCCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181821.1-723s21c1
Sequence:CCGGTATCGTGGAGCTCTGAGTATTCTCGAGAATACTCAGAGCTCCACGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181821.1-447s21c1
Sequence:CCGGCGGCCTAAACGCCAGTCTTTCCTCGAGGAAAGACTGGCGTTTAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181821.1-762s21c1
Sequence:CCGGCTATCTTCTTTCTGACAACAACTCGAGTTGTTGTCAGAAAGAAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181821.1-479s1c1
Sequence:CCGGCTTTGCACAAGCAGTTCCTGTCTCGAGACAGGAACTGCTTGTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181821.1-532s1c1
Sequence:CCGGCTCAGCCTACATAATGACCACCTCGAGGTGGTCATTATGTAGGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181821.1-475s1c1
Sequence:CCGGGAACCTTTGCACAAGCAGTTCCTCGAGGAACTGCTTGTGCAAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181821.1-762s1c1
Sequence:CCGGCTATCTTCTTTCTGACAACAACTCGAGTTGTTGTCAGAAAGAAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181821.1-1061s1c1
Sequence:CCGGGCATTGAGAATGTGTGAGTCACTCGAGTGACTCACACATTCTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181821
VALIDATED
HCFC1R1 MISSION shRNA shRNA Plasmid DNA
host cell factor C1 regulator 1 (XPO1 dependent)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181821.1-532s21c1
Sequence:CCGGCTCAGCCTACATAATGACCACCTCGAGGTGGTCATTATGTAGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181821.1-506s21c1
Sequence:CCGGAGAACATGGCCACCCATTTCTCTCGAGAGAAATGGGTGGCCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181821.1-723s21c1
Sequence:CCGGTATCGTGGAGCTCTGAGTATTCTCGAGAATACTCAGAGCTCCACGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181821.1-447s21c1
Sequence:CCGGCGGCCTAAACGCCAGTCTTTCCTCGAGGAAAGACTGGCGTTTAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181821.1-762s21c1
Sequence:CCGGCTATCTTCTTTCTGACAACAACTCGAGTTGTTGTCAGAAAGAAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181821.1-479s1c1
Sequence:CCGGCTTTGCACAAGCAGTTCCTGTCTCGAGACAGGAACTGCTTGTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181821.1-532s1c1
Sequence:CCGGCTCAGCCTACATAATGACCACCTCGAGGTGGTCATTATGTAGGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181821.1-475s1c1
Sequence:CCGGGAACCTTTGCACAAGCAGTTCCTCGAGGAACTGCTTGTGCAAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181821.1-762s1c1
Sequence:CCGGCTATCTTCTTTCTGACAACAACTCGAGTTGTTGTCAGAAAGAAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181821.1-1061s1c1
Sequence:CCGGGCATTGAGAATGTGTGAGTCACTCGAGTGACTCACACATTCTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181821
VALIDATED
HCFC1R1 MISSION shRNA Lentiviral Transduction Particles
host cell factor C1 regulator 1 (XPO1 dependent)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181821.1-532s21c1
Sequence:CCGGCTCAGCCTACATAATGACCACCTCGAGGTGGTCATTATGTAGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181821.1-506s21c1
Sequence:CCGGAGAACATGGCCACCCATTTCTCTCGAGAGAAATGGGTGGCCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181821.1-723s21c1
Sequence:CCGGTATCGTGGAGCTCTGAGTATTCTCGAGAATACTCAGAGCTCCACGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181821.1-447s21c1
Sequence:CCGGCGGCCTAAACGCCAGTCTTTCCTCGAGGAAAGACTGGCGTTTAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181821.1-762s21c1
Sequence:CCGGCTATCTTCTTTCTGACAACAACTCGAGTTGTTGTCAGAAAGAAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181821.1-479s1c1
Sequence:CCGGCTTTGCACAAGCAGTTCCTGTCTCGAGACAGGAACTGCTTGTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181821.1-532s1c1
Sequence:CCGGCTCAGCCTACATAATGACCACCTCGAGGTGGTCATTATGTAGGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181821.1-475s1c1
Sequence:CCGGGAACCTTTGCACAAGCAGTTCCTCGAGGAACTGCTTGTGCAAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181821.1-762s1c1
Sequence:CCGGCTATCTTCTTTCTGACAACAACTCGAGTTGTTGTCAGAAAGAAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181821.1-1061s1c1
Sequence:CCGGGCATTGAGAATGTGTGAGTCACTCGAGTGACTCACACATTCTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002017
VALIDATED
HCFC1R1 MISSION shRNA Bacterial Glycerol Stock
host cell factor C1 regulator 1 (XPO1 dependent)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002017.1-688s21c1
Sequence:CCGGGACATAATGGAGCTCTGAGTGCTCGAGCACTCAGAGCTCCATTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002017.1-447s21c1
Sequence:CCGGTCTGCGCAAGCAGTTTCTGTCCTCGAGGACAGAAACTGCTTGCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002017.1-494s21c1
Sequence:CCGGCTCAACTCAGCCTGCACAATGCTCGAGCATTGTGCAGGCTGAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002017.1-746s21c1
Sequence:CCGGACAACAGAAGAGACCAGCGACCTCGAGGTCGCTGGTCTCTTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002017.1-576s21c1
Sequence:CCGGTTGCTCTGAGCTGCTTCTCTGCTCGAGCAGAGAAGCAGCTCAGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002017
VALIDATED
HCFC1R1 MISSION shRNA shRNA Plasmid DNA
host cell factor C1 regulator 1 (XPO1 dependent)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002017.1-688s21c1
Sequence:CCGGGACATAATGGAGCTCTGAGTGCTCGAGCACTCAGAGCTCCATTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002017.1-447s21c1
Sequence:CCGGTCTGCGCAAGCAGTTTCTGTCCTCGAGGACAGAAACTGCTTGCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002017.1-494s21c1
Sequence:CCGGCTCAACTCAGCCTGCACAATGCTCGAGCATTGTGCAGGCTGAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002017.1-746s21c1
Sequence:CCGGACAACAGAAGAGACCAGCGACCTCGAGGTCGCTGGTCTCTTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002017.1-576s21c1
Sequence:CCGGTTGCTCTGAGCTGCTTCTCTGCTCGAGCAGAGAAGCAGCTCAGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002017
VALIDATED
HCFC1R1 MISSION shRNA Lentiviral Transduction Particles
host cell factor C1 regulator 1 (XPO1 dependent)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002017.1-688s21c1
Sequence:CCGGGACATAATGGAGCTCTGAGTGCTCGAGCACTCAGAGCTCCATTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002017.1-447s21c1
Sequence:CCGGTCTGCGCAAGCAGTTTCTGTCCTCGAGGACAGAAACTGCTTGCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002017.1-494s21c1
Sequence:CCGGCTCAACTCAGCCTGCACAATGCTCGAGCATTGTGCAGGCTGAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002017.1-746s21c1
Sequence:CCGGACAACAGAAGAGACCAGCGACCTCGAGGTCGCTGGTCTCTTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002017.1-576s21c1
Sequence:CCGGTTGCTCTGAGCTGCTTCTCTGCTCGAGCAGAGAAGCAGCTCAGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks