EMAIL THIS PAGE TO A FRIEND

HCG27

HLA complex group 27 (non-protein coding)

Synonyms: bCX101P6.9 bPG299F13.9 bQB115I13.2
Species: Human HCG27(253018)
Gene ID:
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181717 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181717 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060724 predicted 731
2 SASI_Hs01_00060725 predicted 724
3 SASI_Hs01_00060726 predicted 313
4 SASI_Hs01_00060727 predicted 305
5 SASI_Hs01_00060728 predicted 303
6 SASI_Hs01_00060730 predicted 850
7 SASI_Hs02_00370327 predicted 427
8 SASI_Hs01_00060731 predicted 448
9 SASI_Hs01_00060732 predicted 575
10 SASI_Hs01_00060733 predicted 563
11 SASI_Hs01_00060729 predicted 877
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181717
HCG27 MISSION shRNA Bacterial Glycerol Stock
HLA complex group 27 (non-protein coding)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166332    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1510s1c1
Sequence:CCGGCCCAGAACATGCTTGCTAGTACTCGAGTACTAGCAAGCATGTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1347s1c1
Sequence:CCGGCCTGTACAGAACACGTGCATTCTCGAGAATGCACGTGTTCTGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160483    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1548s1c1
Sequence:CCGGCCTCCTGTAAATAATCATGTACTCGAGTACATGATTATTTACAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161544    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1262s1c1
Sequence:CCGGGACCACACAATCAACACAATACTCGAGTATTGTGTTGATTGTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163572    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1125s1c1
Sequence:CCGGGCTGCACTGAATAAGCTGTAACTCGAGTTACAGCTTATTCAGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163793    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1324s1c1
Sequence:CCGGGCTATCTCCAATAGGGAGTTTCTCGAGAAACTCCCTATTGGAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1423s1c1
Sequence:CCGGCCCTGGGTGGAGATTTAAGATCTCGAGATCTTAAATCTCCACCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181717
HCG27 MISSION shRNA shRNA Plasmid DNA
HLA complex group 27 (non-protein coding)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166332    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1510s1c1
Sequence:CCGGCCCAGAACATGCTTGCTAGTACTCGAGTACTAGCAAGCATGTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1347s1c1
Sequence:CCGGCCTGTACAGAACACGTGCATTCTCGAGAATGCACGTGTTCTGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160483    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1548s1c1
Sequence:CCGGCCTCCTGTAAATAATCATGTACTCGAGTACATGATTATTTACAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161544    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1262s1c1
Sequence:CCGGGACCACACAATCAACACAATACTCGAGTATTGTGTTGATTGTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163572    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1125s1c1
Sequence:CCGGGCTGCACTGAATAAGCTGTAACTCGAGTTACAGCTTATTCAGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163793    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1324s1c1
Sequence:CCGGGCTATCTCCAATAGGGAGTTTCTCGAGAAACTCCCTATTGGAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1423s1c1
Sequence:CCGGCCCTGGGTGGAGATTTAAGATCTCGAGATCTTAAATCTCCACCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181717
HCG27 MISSION shRNA Lentiviral Transduction Particles
HLA complex group 27 (non-protein coding)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166332    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1510s1c1
Sequence:CCGGCCCAGAACATGCTTGCTAGTACTCGAGTACTAGCAAGCATGTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1347s1c1
Sequence:CCGGCCTGTACAGAACACGTGCATTCTCGAGAATGCACGTGTTCTGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160483    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1548s1c1
Sequence:CCGGCCTCCTGTAAATAATCATGTACTCGAGTACATGATTATTTACAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161544    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1262s1c1
Sequence:CCGGGACCACACAATCAACACAATACTCGAGTATTGTGTTGATTGTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163572    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1125s1c1
Sequence:CCGGGCTGCACTGAATAAGCTGTAACTCGAGTTACAGCTTATTCAGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163793    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1324s1c1
Sequence:CCGGGCTATCTCCAATAGGGAGTTTCTCGAGAAACTCCCTATTGGAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181717.1-1423s1c1
Sequence:CCGGCCCTGGGTGGAGATTTAAGATCTCGAGATCTTAAATCTCCACCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks