EMAIL THIS PAGE TO A FRIEND

HDAC8

histone deacetylase 8

Synonyms: CDLS5 HD8 HDACL1 MRXS6 RPD3 WTS
Gene ID:
Human(55869) Summary: Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class I of the histone deacetylase family. It catalyzes the deacetylation of lysine residues in the histone N-terminal tails and represses transcription in large multiprotein complexes with transcriptional co-repressors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(70315) histone deacetylase 8
Rat(363481) histone deacetylase 8
Zebrafish(406740) histone deacetylase 8
cow(540666) histone deacetylase 8
domestic cat(101096383) histone deacetylase 8
dog(480957) histone deacetylase 8
chicken(422182) histone deacetylase 8
domestic guinea pig(100721893) histone deacetylase 8
naked mole-rat(101697998) histone deacetylase 8
sheep(101110121) histone deacetylase 8
Gene Class: Deacetylase
147 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108492 Anti-HDAC8 affinity isolated antibody pig, horse, bovine, zebrafish, guinea pig, canine, human, rat, rabbit, mouse
western blot pricing
AV34587 Anti-HDAC8 antibody produced in rabbit affinity isolated antibody guinea pig, horse, rabbit, zebrafish, rat, mouse, bovine, human
western blot pricing
HPA048560 Anti-HDAC8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2103075 Anti-HDAC8, (N-terminal) antibody produced in rabbit affinity isolated antibody human, rat, rabbit, mouse, bovine, guinea pig, horse, canine
western blot pricing
SAB4502369 Anti-HDAC8, N-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
H8038 Anti-Histone Deacetylase 8 (HDAC8) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunocytochemistry, immunoprecipitation, western blot pricing
SAB4300105 Anti-phospho-HDAC8 (pSer39) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry pricing
SAB4504424 Anti-phospho-HDAC8 (pSer39) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
WH0055869M1 Monoclonal Anti-HDAC8 antibody produced in mouse clone 2F4, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, western blot pricing
SAB1405167 Monoclonal Anti-HDAC8, (N-terminal) antibody produced in mouse clone 2F4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
H6412 Monoclonal Anti-Histone Deacetylase 8 (HDAC8) antibody produced in mouse 2.0-2.5 mg/mL, clone HDAC8-48, purified immunoglobulin, buffered aqueous solution human
ELISA, microarray, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T8552 Trichostatin A ≥98% (HPLC), from Streptomyces sp. human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018486 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018486 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018486 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_135999 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_135999 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_135999 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018486 Rosetta Predictions human pricing
NM_001126373 Rosetta Predictions rat pricing
NM_027382 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103586 predicted 906
2 SASI_Hs02_00352074 predicted 545
3 SASI_Hs01_00103588 predicted 894
4 SASI_Hs01_00103589 predicted 1246
5 SASI_Hs01_00103590 predicted 878
6 SASI_Hs02_00352075 predicted 1022
7 SASI_Hs01_00103591 predicted 536
8 SASI_Hs01_00103592 predicted 883
9 SASI_Hs02_00352076 predicted 1251
10 SASI_Hs01_00103593 predicted 730
11 SASI_Hs01_00103587 predicted 788
12 SASI_Hs01_00103594 predicted 723
13 SASI_Hs01_00103595 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126373 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253433 predicted 431
2 SASI_Rn02_00253434 predicted 968
3 SASI_Rn02_00253435 predicted 888
4 SASI_Rn02_00253436 predicted 403
5 SASI_Rn02_00253437 predicted 633
6 SASI_Rn02_00253438 predicted 861
7 SASI_Rn02_00253439 predicted 316
8 SASI_Rn02_00253440 predicted 1010
9 SASI_Rn02_00253441 predicted 759
10 SASI_Rn02_00253442 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107278 predicted 1274
2 SASI_Mm01_00107279 predicted 756
3 SASI_Mm01_00107280 predicted 422
4 SASI_Mm01_00107281 predicted 360
5 SASI_Mm01_00107282 predicted 574
6 SASI_Mm01_00107283 predicted 878
7 SASI_Mm02_00332095 predicted 654
8 SASI_Mm01_00107284 predicted 795
9 SASI_Mm01_00107285 predicted 224
10 SASI_Mm01_00107286 predicted 879
11 SASI_Mm01_00107287 predicted 1180
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018486
VALIDATED
HDAC8 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 8
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018486.1-552s21c1
Sequence:CCGGGCGTATTCTCTACGTGGATTTCTCGAGAAATCCACGTAGAGAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018486.1-77s21c1
Sequence:CCGGAGTCGCTGGTCCCGGTTTATACTCGAGTATAAACCGGGACCAGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018486.1-430s21c1
Sequence:CCGGATGTGCAAAGTAGCAATTAACCTCGAGGTTAATTGCTACTTTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018486.1-529s21c1
Sequence:CCGGTTACGATTGCGACGGAAATTTCTCGAGAAATTTCCGTCGCAATCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018486.1-1205s21c1
Sequence:CCGGCTGAGGAGTGGTGCCTATAATCTCGAGATTATAGGCACCACTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197281    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018486.1-1233s1c1
Sequence:CCGGGCGTGTTTATGCAAGCAGTTTCTCGAGAAACTGCTTGCATAAACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018486.1-1053s1c1
Sequence:CCGGCACAGCATATGGTCCTGATTACTCGAGTAATCAGGACCATATGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018486.1-411s1c1
Sequence:CCGGCCAATGCCTGATTGACGGAATCTCGAGATTCCGTCAATCAGGCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018486.1-1122s1c1
Sequence:CCGGCCGAATCCAACAAATCCTCAACTCGAGTTGAGGATTTGTTGGATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018486.1-552s1c1
Sequence:CCGGGCGTATTCTCTACGTGGATTTCTCGAGAAATCCACGTAGAGAATACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_018486.1-165s1c1
Sequence:CCGGGCATTCTTTGATTGAAGCATACTCGAGTATGCTTCAATCAAAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018486.1-1178s1c1
Sequence:CCGGTGACAGAAAGAGATCAGGTTTCTCGAGAAACCTGATCTCTTTCTGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018486
VALIDATED
HDAC8 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 8
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018486.1-552s21c1
Sequence:CCGGGCGTATTCTCTACGTGGATTTCTCGAGAAATCCACGTAGAGAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018486.1-77s21c1
Sequence:CCGGAGTCGCTGGTCCCGGTTTATACTCGAGTATAAACCGGGACCAGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018486.1-430s21c1
Sequence:CCGGATGTGCAAAGTAGCAATTAACCTCGAGGTTAATTGCTACTTTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018486.1-529s21c1
Sequence:CCGGTTACGATTGCGACGGAAATTTCTCGAGAAATTTCCGTCGCAATCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018486.1-1205s21c1
Sequence:CCGGCTGAGGAGTGGTGCCTATAATCTCGAGATTATAGGCACCACTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197281    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018486.1-1233s1c1
Sequence:CCGGGCGTGTTTATGCAAGCAGTTTCTCGAGAAACTGCTTGCATAAACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018486.1-1053s1c1
Sequence:CCGGCACAGCATATGGTCCTGATTACTCGAGTAATCAGGACCATATGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018486.1-411s1c1
Sequence:CCGGCCAATGCCTGATTGACGGAATCTCGAGATTCCGTCAATCAGGCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018486.1-1122s1c1
Sequence:CCGGCCGAATCCAACAAATCCTCAACTCGAGTTGAGGATTTGTTGGATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018486.1-552s1c1
Sequence:CCGGGCGTATTCTCTACGTGGATTTCTCGAGAAATCCACGTAGAGAATACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_018486.1-165s1c1
Sequence:CCGGGCATTCTTTGATTGAAGCATACTCGAGTATGCTTCAATCAAAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018486.1-1178s1c1
Sequence:CCGGTGACAGAAAGAGATCAGGTTTCTCGAGAAACCTGATCTCTTTCTGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018486
VALIDATED
HDAC8 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 8
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018486.1-552s21c1
Sequence:CCGGGCGTATTCTCTACGTGGATTTCTCGAGAAATCCACGTAGAGAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018486.1-77s21c1
Sequence:CCGGAGTCGCTGGTCCCGGTTTATACTCGAGTATAAACCGGGACCAGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018486.1-430s21c1
Sequence:CCGGATGTGCAAAGTAGCAATTAACCTCGAGGTTAATTGCTACTTTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018486.1-529s21c1
Sequence:CCGGTTACGATTGCGACGGAAATTTCTCGAGAAATTTCCGTCGCAATCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018486.1-1205s21c1
Sequence:CCGGCTGAGGAGTGGTGCCTATAATCTCGAGATTATAGGCACCACTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197281    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018486.1-1233s1c1
Sequence:CCGGGCGTGTTTATGCAAGCAGTTTCTCGAGAAACTGCTTGCATAAACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018486.1-1053s1c1
Sequence:CCGGCACAGCATATGGTCCTGATTACTCGAGTAATCAGGACCATATGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018486.1-411s1c1
Sequence:CCGGCCAATGCCTGATTGACGGAATCTCGAGATTCCGTCAATCAGGCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018486.1-1122s1c1
Sequence:CCGGCCGAATCCAACAAATCCTCAACTCGAGTTGAGGATTTGTTGGATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018486.1-552s1c1
Sequence:CCGGGCGTATTCTCTACGTGGATTTCTCGAGAAATCCACGTAGAGAATACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_018486.1-165s1c1
Sequence:CCGGGCATTCTTTGATTGAAGCATACTCGAGTATGCTTCAATCAAAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018486.1-1178s1c1
Sequence:CCGGTGACAGAAAGAGATCAGGTTTCTCGAGAAACCTGATCTCTTTCTGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_135999
HDAC8 MISSION shRNA Bacterial Glycerol Stock
histone deacetylase 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_135999.3-1643s1c1
Sequence:CCGGGCCAGTGTTTAAAGTGTTTATCTCGAGATAAACACTTTAAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135999.3-818s1c1
Sequence:CCGGGTGGATTTGGATCTACACCATCTCGAGATGGTGTAGATCCAAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135999.3-573s1c1
Sequence:CCGGCCATAGAATATGGACTAGGTTCTCGAGAACCTAGTCCATATTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135999.3-1091s1c1
Sequence:CCGGGCAGATACTATTGCCGGAGATCTCGAGATCTCCGGCAATAGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135999.3-967s1c1
Sequence:CCGGCTACAGTGTCAATGTGCCCATCTCGAGATGGGCACATTGACACTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_135999
HDAC8 MISSION shRNA shRNA Plasmid DNA
histone deacetylase 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_135999.3-1643s1c1
Sequence:CCGGGCCAGTGTTTAAAGTGTTTATCTCGAGATAAACACTTTAAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135999.3-818s1c1
Sequence:CCGGGTGGATTTGGATCTACACCATCTCGAGATGGTGTAGATCCAAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135999.3-573s1c1
Sequence:CCGGCCATAGAATATGGACTAGGTTCTCGAGAACCTAGTCCATATTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135999.3-1091s1c1
Sequence:CCGGGCAGATACTATTGCCGGAGATCTCGAGATCTCCGGCAATAGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135999.3-967s1c1
Sequence:CCGGCTACAGTGTCAATGTGCCCATCTCGAGATGGGCACATTGACACTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_135999
HDAC8 MISSION shRNA Lentiviral Transduction Particles
histone deacetylase 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_135999.3-1643s1c1
Sequence:CCGGGCCAGTGTTTAAAGTGTTTATCTCGAGATAAACACTTTAAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135999.3-818s1c1
Sequence:CCGGGTGGATTTGGATCTACACCATCTCGAGATGGTGTAGATCCAAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135999.3-573s1c1
Sequence:CCGGCCATAGAATATGGACTAGGTTCTCGAGAACCTAGTCCATATTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135999.3-1091s1c1
Sequence:CCGGGCAGATACTATTGCCGGAGATCTCGAGATCTCCGGCAATAGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135999.3-967s1c1
Sequence:CCGGCTACAGTGTCAATGTGCCCATCTCGAGATGGGCACATTGACACTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks