EMAIL THIS PAGE TO A FRIEND

HDHD2

haloacid dehalogenase-like hydrolase domain containing 2

Synonyms: 3110052N05Rik
UniProtKB ID: Q9H0R4, A8K7T3, Q96NV4
Gene ID:
Mouse(76987) haloacid dehalogenase-like hydrolase domain containing 2
Rat(361351) haloacid dehalogenase-like hydrolase domain containing 2
Zebrafish(541346) haloacid dehalogenase-like hydrolase domain containing 2
chicken(416385) haloacid dehalogenase-like hydrolase domain containing 2
dog(480146) haloacid dehalogenase-like hydrolase domain containing 2
domestic cat(101082445) haloacid dehalogenase-like hydrolase domain containing 2
cow(505403) haloacid dehalogenase-like hydrolase domain containing 2
sheep(101113642) haloacid dehalogenase-like hydrolase domain containing 2
domestic guinea pig(100727515) haloacid dehalogenase-like hydrolase domain containing 2
naked mole-rat(101710844) haloacid dehalogenase-like hydrolase domain containing 2
147 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029826 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029826 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029826 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032124 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032124 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032124 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028761 MISSION® esiRNA esiRNA human HDHD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032124 Rosetta Predictions human pricing
NM_001014151 Rosetta Predictions rat pricing
NM_001039201 Rosetta Predictions mouse pricing
NM_001039202 Rosetta Predictions mouse pricing
NM_029826 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146376 predicted 291
2 SASI_Hs01_00146377 predicted 563
3 SASI_Hs01_00146378 predicted 801
4 SASI_Hs01_00146379 predicted 565
5 SASI_Hs01_00146380 predicted 938
6 SASI_Hs01_00146382 predicted 710
7 SASI_Hs01_00146383 predicted 794
8 SASI_Hs01_00146384 predicted 958
9 SASI_Hs01_00146385 predicted 335
10 SASI_Hs02_00359334 predicted 286
11 SASI_Hs01_00146381 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014151 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201627 predicted 445
2 SASI_Rn02_00201628 predicted 483
3 SASI_Rn02_00201629 predicted 533
4 SASI_Rn02_00201630 predicted 643
5 SASI_Rn01_00063065 predicted 758
6 SASI_Rn02_00201631 predicted 527
7 SASI_Rn02_00201632 predicted 527
8 SASI_Rn02_00201633 predicted 410
9 SASI_Rn02_00201634 predicted 263
10 SASI_Rn02_00201635 predicted 604
11 SASI_Rn01_00063063 predicted 976
12 SASI_Rn01_00063064 predicted 538
13 SASI_Rn01_00063066 predicted 982
14 SASI_Rn01_00063067 predicted 830
15 SASI_Rn01_00063068 predicted 1302
16 SASI_Rn01_00063069 predicted 604
17 SASI_Rn01_00063070 predicted 670
18 SASI_Rn01_00063071 predicted 357
19 SASI_Rn01_00063072 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039201 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033427 predicted 1029
2 SASI_Mm01_00033428 predicted 926
3 SASI_Mm01_00033429 predicted 355
4 SASI_Mm01_00033430 predicted 1080
5 SASI_Mm01_00033431 predicted 959
6 SASI_Mm01_00033432 predicted 587
7 SASI_Mm01_00033433 predicted 711
8 SASI_Mm01_00033434 predicted 1025
9 SASI_Mm01_00033435 predicted 393
10 SASI_Mm01_00033436 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039202 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188299 predicted 651
2 SASI_Mm01_00188300 predicted 311
3 SASI_Mm01_00188301 predicted 813
4 SASI_Mm01_00188302 predicted 582
5 SASI_Mm01_00188303 predicted 373
6 SASI_Mm01_00188304 predicted 643
7 SASI_Mm01_00188305 predicted 793
8 SASI_Mm01_00188306 predicted 623
9 SASI_Mm01_00188307 predicted 529
10 SASI_Mm01_00188308 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135284 predicted 987
2 SASI_Mm01_00135285 predicted 884
3 SASI_Mm01_00135286 predicted 314
4 SASI_Mm01_00135287 predicted 1036
5 SASI_Mm01_00135288 predicted 921
6 SASI_Mm01_00135289 predicted 545
7 SASI_Mm01_00135290 predicted 674
8 SASI_Mm01_00135291 predicted 983
9 SASI_Mm01_00135292 predicted 355
10 SASI_Mm01_00135293 predicted 790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029826
VALIDATED
HDHD2 MISSION shRNA Bacterial Glycerol Stock
haloacid dehalogenase-like hydrolase domain containing 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029826.1-312s1c1
Sequence:CCGGCCGAAACTTAATCGAGCAGAACTCGAGTTCTGCTCGATTAAGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029826.1-795s1c1
Sequence:CCGGCTACTTAACTTGCGAGAGCTTCTCGAGAAGCTCTCGCAAGTTAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029826.1-374s1c1
Sequence:CCGGCTGAGTTCACAGGAGTTCAAACTCGAGTTTGAACTCCTGTGAACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029826.1-983s1c1
Sequence:CCGGGCCAACCCTAAACCTTGCTAACTCGAGTTAGCAAGGTTTAGGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029826.1-489s1c1
Sequence:CCGGCCCTCTGATAGCTATCCACAACTCGAGTTGTGGATAGCTATCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-678s21c1
Sequence:CCGGCGTCATGATAGGAGACGATTGCTCGAGCAATCGTCTCCTATCATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-789s21c1
Sequence:CCGGTAATCCACCTCCCTACTTAACCTCGAGGTTAAGTAGGGAGGTGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-728s21c1
Sequence:CCGGTTGGCATGCTGGGCATCTTAGCTCGAGCTAAGATGCCCAGCATGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-426s21c1
Sequence:CCGGTGGACTGGCACCAGAGCATTTCTCGAGAAATGCTCTGGTGCCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-566s21c1
Sequence:CCGGTTGTGACTGCCTTAGAGTATGCTCGAGCATACTCTAAGGCAGTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-159s21c1
Sequence:CCGGAGGCGCACAGGAAGCTCTTAACTCGAGTTAAGAGCTTCCTGTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-204s21c1
Sequence:CCGGGGTTCGGTTTGTGACCAATACCTCGAGGTATTGGTCACAAACCGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029826
VALIDATED
HDHD2 MISSION shRNA shRNA Plasmid DNA
haloacid dehalogenase-like hydrolase domain containing 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029826.1-312s1c1
Sequence:CCGGCCGAAACTTAATCGAGCAGAACTCGAGTTCTGCTCGATTAAGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029826.1-795s1c1
Sequence:CCGGCTACTTAACTTGCGAGAGCTTCTCGAGAAGCTCTCGCAAGTTAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029826.1-374s1c1
Sequence:CCGGCTGAGTTCACAGGAGTTCAAACTCGAGTTTGAACTCCTGTGAACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029826.1-983s1c1
Sequence:CCGGGCCAACCCTAAACCTTGCTAACTCGAGTTAGCAAGGTTTAGGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029826.1-489s1c1
Sequence:CCGGCCCTCTGATAGCTATCCACAACTCGAGTTGTGGATAGCTATCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-678s21c1
Sequence:CCGGCGTCATGATAGGAGACGATTGCTCGAGCAATCGTCTCCTATCATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-789s21c1
Sequence:CCGGTAATCCACCTCCCTACTTAACCTCGAGGTTAAGTAGGGAGGTGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-728s21c1
Sequence:CCGGTTGGCATGCTGGGCATCTTAGCTCGAGCTAAGATGCCCAGCATGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-426s21c1
Sequence:CCGGTGGACTGGCACCAGAGCATTTCTCGAGAAATGCTCTGGTGCCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-566s21c1
Sequence:CCGGTTGTGACTGCCTTAGAGTATGCTCGAGCATACTCTAAGGCAGTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-159s21c1
Sequence:CCGGAGGCGCACAGGAAGCTCTTAACTCGAGTTAAGAGCTTCCTGTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-204s21c1
Sequence:CCGGGGTTCGGTTTGTGACCAATACCTCGAGGTATTGGTCACAAACCGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029826
VALIDATED
HDHD2 MISSION shRNA Lentiviral Transduction Particles
haloacid dehalogenase-like hydrolase domain containing 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029826.1-312s1c1
Sequence:CCGGCCGAAACTTAATCGAGCAGAACTCGAGTTCTGCTCGATTAAGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029826.1-795s1c1
Sequence:CCGGCTACTTAACTTGCGAGAGCTTCTCGAGAAGCTCTCGCAAGTTAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029826.1-374s1c1
Sequence:CCGGCTGAGTTCACAGGAGTTCAAACTCGAGTTTGAACTCCTGTGAACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029826.1-983s1c1
Sequence:CCGGGCCAACCCTAAACCTTGCTAACTCGAGTTAGCAAGGTTTAGGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029826.1-489s1c1
Sequence:CCGGCCCTCTGATAGCTATCCACAACTCGAGTTGTGGATAGCTATCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-678s21c1
Sequence:CCGGCGTCATGATAGGAGACGATTGCTCGAGCAATCGTCTCCTATCATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-789s21c1
Sequence:CCGGTAATCCACCTCCCTACTTAACCTCGAGGTTAAGTAGGGAGGTGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-728s21c1
Sequence:CCGGTTGGCATGCTGGGCATCTTAGCTCGAGCTAAGATGCCCAGCATGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-426s21c1
Sequence:CCGGTGGACTGGCACCAGAGCATTTCTCGAGAAATGCTCTGGTGCCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-566s21c1
Sequence:CCGGTTGTGACTGCCTTAGAGTATGCTCGAGCATACTCTAAGGCAGTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-159s21c1
Sequence:CCGGAGGCGCACAGGAAGCTCTTAACTCGAGTTAAGAGCTTCCTGTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029826.2-204s21c1
Sequence:CCGGGGTTCGGTTTGTGACCAATACCTCGAGGTATTGGTCACAAACCGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032124
VALIDATED
HDHD2 MISSION shRNA Bacterial Glycerol Stock
haloacid dehalogenase-like hydrolase domain containing 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032124.3-627s1c1
Sequence:CCGGCTTTAGAGTATGCCACAGATACTCGAGTATCTGTGGCATACTCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_032124.3-569s1c1
Sequence:CCGGGCCAGGTATTACAAGAGGAAACTCGAGTTTCCTCTTGTAATACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032124.3-298s1c1
Sequence:CCGGCCTGTTAGAAAGGTTGAGAAACTCGAGTTTCTCAACCTTTCTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032124.3-548s1c1
Sequence:CCGGCCTCTGATAGCAATCCACAAACTCGAGTTTGTGGATTGCTATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032124.3-796s1c1
Sequence:CCGGCTTAGTAAAGACTGGGAAATACTCGAGTATTTCCCAGTCTTTACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_032124.4-418s21c1
Sequence:CCGGTGATCGGGCACTACCTGATTTCTCGAGAAATCAGGTAGTGCCCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_032124.4-890s21c1
Sequence:CCGGCACATTCTGCAGCACCTATTGCTCGAGCAATAGGTGCTGCAGAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_032124.4-1067s21c1
Sequence:CCGGGAATTGCGGCTAGCCAGTAAGCTCGAGCTTACTGGCTAGCCGCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_032124.4-211s21c1
Sequence:CCGGAGGCGCACAGGAAGCTCTTAACTCGAGTTAAGAGCTTCCTGTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032124.4-569s21c1
Sequence:CCGGGCCAGGTATTACAAGAGGAAACTCGAGTTTCCTCTTGTAATACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032124.4-548s21c1
Sequence:CCGGCCTCTGATAGCAATCCACAAACTCGAGTTTGTGGATTGCTATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032124.4-1328s21c1
Sequence:CCGGTTAGGCTGTAGTTCTAATATTCTCGAGAATATTAGAACTACAGCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032124
VALIDATED
HDHD2 MISSION shRNA shRNA Plasmid DNA
haloacid dehalogenase-like hydrolase domain containing 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032124.3-627s1c1
Sequence:CCGGCTTTAGAGTATGCCACAGATACTCGAGTATCTGTGGCATACTCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_032124.3-569s1c1
Sequence:CCGGGCCAGGTATTACAAGAGGAAACTCGAGTTTCCTCTTGTAATACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032124.3-298s1c1
Sequence:CCGGCCTGTTAGAAAGGTTGAGAAACTCGAGTTTCTCAACCTTTCTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032124.3-548s1c1
Sequence:CCGGCCTCTGATAGCAATCCACAAACTCGAGTTTGTGGATTGCTATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032124.3-796s1c1
Sequence:CCGGCTTAGTAAAGACTGGGAAATACTCGAGTATTTCCCAGTCTTTACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_032124.4-418s21c1
Sequence:CCGGTGATCGGGCACTACCTGATTTCTCGAGAAATCAGGTAGTGCCCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_032124.4-890s21c1
Sequence:CCGGCACATTCTGCAGCACCTATTGCTCGAGCAATAGGTGCTGCAGAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_032124.4-1067s21c1
Sequence:CCGGGAATTGCGGCTAGCCAGTAAGCTCGAGCTTACTGGCTAGCCGCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_032124.4-211s21c1
Sequence:CCGGAGGCGCACAGGAAGCTCTTAACTCGAGTTAAGAGCTTCCTGTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032124.4-569s21c1
Sequence:CCGGGCCAGGTATTACAAGAGGAAACTCGAGTTTCCTCTTGTAATACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032124.4-548s21c1
Sequence:CCGGCCTCTGATAGCAATCCACAAACTCGAGTTTGTGGATTGCTATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032124.4-1328s21c1
Sequence:CCGGTTAGGCTGTAGTTCTAATATTCTCGAGAATATTAGAACTACAGCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032124
VALIDATED
HDHD2 MISSION shRNA Lentiviral Transduction Particles
haloacid dehalogenase-like hydrolase domain containing 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032124.3-627s1c1
Sequence:CCGGCTTTAGAGTATGCCACAGATACTCGAGTATCTGTGGCATACTCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_032124.3-569s1c1
Sequence:CCGGGCCAGGTATTACAAGAGGAAACTCGAGTTTCCTCTTGTAATACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032124.3-298s1c1
Sequence:CCGGCCTGTTAGAAAGGTTGAGAAACTCGAGTTTCTCAACCTTTCTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032124.3-548s1c1
Sequence:CCGGCCTCTGATAGCAATCCACAAACTCGAGTTTGTGGATTGCTATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032124.3-796s1c1
Sequence:CCGGCTTAGTAAAGACTGGGAAATACTCGAGTATTTCCCAGTCTTTACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_032124.4-418s21c1
Sequence:CCGGTGATCGGGCACTACCTGATTTCTCGAGAAATCAGGTAGTGCCCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_032124.4-890s21c1
Sequence:CCGGCACATTCTGCAGCACCTATTGCTCGAGCAATAGGTGCTGCAGAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_032124.4-1067s21c1
Sequence:CCGGGAATTGCGGCTAGCCAGTAAGCTCGAGCTTACTGGCTAGCCGCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_032124.4-211s21c1
Sequence:CCGGAGGCGCACAGGAAGCTCTTAACTCGAGTTAAGAGCTTCCTGTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032124.4-569s21c1
Sequence:CCGGGCCAGGTATTACAAGAGGAAACTCGAGTTTCCTCTTGTAATACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032124.4-548s21c1
Sequence:CCGGCCTCTGATAGCAATCCACAAACTCGAGTTTGTGGATTGCTATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032124.4-1328s21c1
Sequence:CCGGTTAGGCTGTAGTTCTAATATTCTCGAGAATATTAGAACTACAGCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks