EMAIL THIS PAGE TO A FRIEND

HEATR1

HEAT repeat containing 1

Synonyms: BAP28 UTP10
UniProtKB ID: Q9H583, Q5T3Q8, Q6P197, Q9NW23
Gene ID:
Mouse(217995) HEAT repeat containing 1
Rat(361262) HEAT repeat containing 1
Zebrafish(334446) HEAT repeat containing 1
chicken(425734) HEAT repeat containing 1
dog(479192) HEAT repeat containing 1
cow(617204) HEAT repeat containing protein 1
cow(506978) HEAT repeat containing 1
Horse(100050411) HEAT repeat containing 1
domestic cat(101085241) HEAT repeat containing 1
sheep(101116117) HEAT repeat containing 1
Domestic Rabbit(100349266) HEAT repeat containing 1
domestic guinea pig(100735112) HEAT repeat containing 1
naked mole-rat(101722456) HEAT repeat containing 1
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018072 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144835 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144835 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144835 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018072 Rosetta Predictions human pricing
NM_001108418 Rosetta Predictions rat pricing
NM_144835 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124676 predicted 2280
2 SASI_Hs01_00124677 predicted 4189
3 SASI_Hs01_00124678 predicted 4492
4 SASI_Hs01_00124679 predicted 2297
5 SASI_Hs01_00124681 predicted 4516
6 SASI_Hs02_00351214 predicted 411
7 SASI_Hs01_00124683 predicted 307
8 SASI_Hs01_00124684 predicted 6313
9 SASI_Hs01_00124685 predicted 2732
10 SASI_Hs02_00351215 predicted 2376
11 SASI_Hs01_00124680 predicted 6365
12 SASI_Hs01_00124682 predicted 1838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108418 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238459 predicted 2903
2 SASI_Rn02_00238460 predicted 2606
3 SASI_Rn02_00238461 predicted 4063
4 SASI_Rn02_00238462 predicted 3750
5 SASI_Rn02_00238463 predicted 6095
6 SASI_Rn02_00238464 predicted 2549
7 SASI_Rn02_00238465 predicted 740
8 SASI_Rn02_00238466 predicted 1117
9 SASI_Rn02_00238467 predicted 4510
10 SASI_Rn02_00238468 predicted 1977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048505 predicted 3686
2 SASI_Mm02_00340225 predicted 831
3 SASI_Mm01_00048507 predicted 2671
4 SASI_Mm01_00048508 predicted 3051
5 SASI_Mm01_00048509 predicted 5777
6 SASI_Mm01_00048510 predicted 411
7 SASI_Mm01_00048511 predicted 5755
8 SASI_Mm01_00048512 predicted 3331
9 SASI_Mm02_00340226 predicted 4754
10 SASI_Mm02_00340227 predicted 4634
11 SASI_Mm01_00048503 predicted 3885
12 SASI_Mm01_00048504 predicted 5656
13 SASI_Mm01_00048506 predicted 3099
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018072
VALIDATED
HEATR1 MISSION shRNA Bacterial Glycerol Stock
HEAT repeat containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018072.4-5477s1c1
Sequence:CCGGCCAGGTGATTCATCTGGAGAACTCGAGTTCTCCAGATGAATCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018072.4-6456s1c1
Sequence:CCGGGCAGAGTTGATGGAAGATGAACTCGAGTTCATCTTCCATCAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018072.4-1434s1c1
Sequence:CCGGCCCAGAACATTAGATGTTGTACTCGAGTACAACATCTAATGTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018072.4-3597s1c1
Sequence:CCGGGCTGAACAAGTCCGAATAGAACTCGAGTTCTATTCGGACTTGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018072.4-6431s1c1
Sequence:CCGGGCTACCAGAATCCATTCCTTTCTCGAGAAAGGAATGGATTCTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018072.4-596s1c1
Sequence:CCGGGCACAGATGGTTCTGGTTGTTCTCGAGAACAACCAGAACCATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018072.4-3597s21c1
Sequence:CCGGGCTGAACAAGTCCGAATAGAACTCGAGTTCTATTCGGACTTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018072.4-596s21c1
Sequence:CCGGGCACAGATGGTTCTGGTTGTTCTCGAGAACAACCAGAACCATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018072.4-6431s21c1
Sequence:CCGGGCTACCAGAATCCATTCCTTTCTCGAGAAAGGAATGGATTCTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018072.4-6456s21c1
Sequence:CCGGGCAGAGTTGATGGAAGATGAACTCGAGTTCATCTTCCATCAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018072
VALIDATED
HEATR1 MISSION shRNA shRNA Plasmid DNA
HEAT repeat containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018072.4-5477s1c1
Sequence:CCGGCCAGGTGATTCATCTGGAGAACTCGAGTTCTCCAGATGAATCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018072.4-6456s1c1
Sequence:CCGGGCAGAGTTGATGGAAGATGAACTCGAGTTCATCTTCCATCAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018072.4-1434s1c1
Sequence:CCGGCCCAGAACATTAGATGTTGTACTCGAGTACAACATCTAATGTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018072.4-3597s1c1
Sequence:CCGGGCTGAACAAGTCCGAATAGAACTCGAGTTCTATTCGGACTTGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018072.4-6431s1c1
Sequence:CCGGGCTACCAGAATCCATTCCTTTCTCGAGAAAGGAATGGATTCTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018072.4-596s1c1
Sequence:CCGGGCACAGATGGTTCTGGTTGTTCTCGAGAACAACCAGAACCATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018072.4-3597s21c1
Sequence:CCGGGCTGAACAAGTCCGAATAGAACTCGAGTTCTATTCGGACTTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018072.4-596s21c1
Sequence:CCGGGCACAGATGGTTCTGGTTGTTCTCGAGAACAACCAGAACCATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018072.4-6431s21c1
Sequence:CCGGGCTACCAGAATCCATTCCTTTCTCGAGAAAGGAATGGATTCTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018072.4-6456s21c1
Sequence:CCGGGCAGAGTTGATGGAAGATGAACTCGAGTTCATCTTCCATCAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018072
VALIDATED
HEATR1 MISSION shRNA Lentiviral Transduction Particles
HEAT repeat containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018072.4-5477s1c1
Sequence:CCGGCCAGGTGATTCATCTGGAGAACTCGAGTTCTCCAGATGAATCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018072.4-6456s1c1
Sequence:CCGGGCAGAGTTGATGGAAGATGAACTCGAGTTCATCTTCCATCAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018072.4-1434s1c1
Sequence:CCGGCCCAGAACATTAGATGTTGTACTCGAGTACAACATCTAATGTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018072.4-3597s1c1
Sequence:CCGGGCTGAACAAGTCCGAATAGAACTCGAGTTCTATTCGGACTTGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018072.4-6431s1c1
Sequence:CCGGGCTACCAGAATCCATTCCTTTCTCGAGAAAGGAATGGATTCTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018072.4-596s1c1
Sequence:CCGGGCACAGATGGTTCTGGTTGTTCTCGAGAACAACCAGAACCATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018072.4-3597s21c1
Sequence:CCGGGCTGAACAAGTCCGAATAGAACTCGAGTTCTATTCGGACTTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018072.4-596s21c1
Sequence:CCGGGCACAGATGGTTCTGGTTGTTCTCGAGAACAACCAGAACCATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018072.4-6431s21c1
Sequence:CCGGGCTACCAGAATCCATTCCTTTCTCGAGAAAGGAATGGATTCTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018072.4-6456s21c1
Sequence:CCGGGCAGAGTTGATGGAAGATGAACTCGAGTTCATCTTCCATCAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144835
HEATR1 MISSION shRNA Bacterial Glycerol Stock
HEAT repeat containing 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144835.3-6603s1c1
Sequence:CCGGGTCACACTCATTCTCATGTTTCTCGAGAAACATGAGAATGAGTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144835.3-5594s1c1
Sequence:CCGGGCCAGCCATTAGCAAGACTTTCTCGAGAAAGTCTTGCTAATGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144835.3-1383s1c1
Sequence:CCGGGCTTTGCTTAATGAGCAGTTTCTCGAGAAACTGCTCATTAAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144835.3-3884s1c1
Sequence:CCGGGCAGTTAATTCTGAGTTGTTTCTCGAGAAACAACTCAGAATTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-1608s21c1
Sequence:CCGGGTGAGACTTCTGGCCGTTAATCTCGAGATTAACGGCCAGAAGTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-2753s21c1
Sequence:CCGGTAGCCTTTCAAATCCACTTAACTCGAGTTAAGTGGATTTGAAAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144835.4-6640s21c1
Sequence:CCGGCCATGTTACTTTCGGTACTTTCTCGAGAAAGTACCGAAAGTAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-4779s21c1
Sequence:CCGGGAAACGGTTCTCAGCTATATTCTCGAGAATATAGCTGAGAACCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-878s21c1
Sequence:CCGGGAAATCCTCTTTACCAGATTACTCGAGTAATCTGGTAAAGAGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-2665s21c1
Sequence:CCGGGGGTTCTGATTAGGCTTATAACTCGAGTTATAAGCCTAATCAGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-540s21c1
Sequence:CCGGTACCATGAGACACGGGTATTTCTCGAGAAATACCCGTGTCTCATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-1698s21c1
Sequence:CCGGACCCGGTTAGGCGATGATAATCTCGAGATTATCATCGCCTAACCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144835
HEATR1 MISSION shRNA shRNA Plasmid DNA
HEAT repeat containing 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144835.3-6603s1c1
Sequence:CCGGGTCACACTCATTCTCATGTTTCTCGAGAAACATGAGAATGAGTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144835.3-5594s1c1
Sequence:CCGGGCCAGCCATTAGCAAGACTTTCTCGAGAAAGTCTTGCTAATGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144835.3-1383s1c1
Sequence:CCGGGCTTTGCTTAATGAGCAGTTTCTCGAGAAACTGCTCATTAAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144835.3-3884s1c1
Sequence:CCGGGCAGTTAATTCTGAGTTGTTTCTCGAGAAACAACTCAGAATTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-1608s21c1
Sequence:CCGGGTGAGACTTCTGGCCGTTAATCTCGAGATTAACGGCCAGAAGTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-2753s21c1
Sequence:CCGGTAGCCTTTCAAATCCACTTAACTCGAGTTAAGTGGATTTGAAAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144835.4-6640s21c1
Sequence:CCGGCCATGTTACTTTCGGTACTTTCTCGAGAAAGTACCGAAAGTAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-4779s21c1
Sequence:CCGGGAAACGGTTCTCAGCTATATTCTCGAGAATATAGCTGAGAACCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-878s21c1
Sequence:CCGGGAAATCCTCTTTACCAGATTACTCGAGTAATCTGGTAAAGAGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-2665s21c1
Sequence:CCGGGGGTTCTGATTAGGCTTATAACTCGAGTTATAAGCCTAATCAGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-540s21c1
Sequence:CCGGTACCATGAGACACGGGTATTTCTCGAGAAATACCCGTGTCTCATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-1698s21c1
Sequence:CCGGACCCGGTTAGGCGATGATAATCTCGAGATTATCATCGCCTAACCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144835
HEATR1 MISSION shRNA Lentiviral Transduction Particles
HEAT repeat containing 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144835.3-6603s1c1
Sequence:CCGGGTCACACTCATTCTCATGTTTCTCGAGAAACATGAGAATGAGTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144835.3-5594s1c1
Sequence:CCGGGCCAGCCATTAGCAAGACTTTCTCGAGAAAGTCTTGCTAATGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144835.3-1383s1c1
Sequence:CCGGGCTTTGCTTAATGAGCAGTTTCTCGAGAAACTGCTCATTAAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144835.3-3884s1c1
Sequence:CCGGGCAGTTAATTCTGAGTTGTTTCTCGAGAAACAACTCAGAATTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-1608s21c1
Sequence:CCGGGTGAGACTTCTGGCCGTTAATCTCGAGATTAACGGCCAGAAGTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-2753s21c1
Sequence:CCGGTAGCCTTTCAAATCCACTTAACTCGAGTTAAGTGGATTTGAAAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144835.4-6640s21c1
Sequence:CCGGCCATGTTACTTTCGGTACTTTCTCGAGAAAGTACCGAAAGTAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-4779s21c1
Sequence:CCGGGAAACGGTTCTCAGCTATATTCTCGAGAATATAGCTGAGAACCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-878s21c1
Sequence:CCGGGAAATCCTCTTTACCAGATTACTCGAGTAATCTGGTAAAGAGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-2665s21c1
Sequence:CCGGGGGTTCTGATTAGGCTTATAACTCGAGTTATAAGCCTAATCAGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-540s21c1
Sequence:CCGGTACCATGAGACACGGGTATTTCTCGAGAAATACCCGTGTCTCATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144835.4-1698s21c1
Sequence:CCGGACCCGGTTAGGCGATGATAATCTCGAGATTATCATCGCCTAACCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks