EMAIL THIS PAGE TO A FRIEND

HECA

headcase homolog (Drosophila)

Synonyms: HDC HDCL HHDC dJ225E12.1
UniProtKB ID: Q9UBI9
Gene ID:
Human(51696) Summary: This gene encodes the homolog of the Drosophila headcase protein, a highly basic, cytoplasmic protein that regulates the re-entry of imaginal cells into the mitotic cycle during adult morphogenesis. In Drosophila, the encoded protein also inhibits terminal branching of neighboring cells during tracheal development. [provided by RefSeq, Jul 2008]
Mouse(380629) headcase homolog (Drosophila)
Rat(308624) headcase homolog (Drosophila)
Zebrafish(567088) headcase homolog (Drosophila)
cow(788673) headcase homolog (Drosophila)
Horse(100065354) headcase homolog (Drosophila)
domestic cat(101088579) headcase homolog (Drosophila)
dog(476223) headcase homolog (Drosophila)
chicken(421677) headcase homolog (Drosophila)
sheep(101122796) headcase homolog (Drosophila)
Domestic Rabbit(100346115) headcase homolog (Drosophila)
domestic guinea pig(100712722) headcase homolog (Drosophila)
naked mole-rat(101699917) headcase homolog (Drosophila)
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016217 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016217 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016217 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033432 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033432 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033432 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016217 Rosetta Predictions human pricing
NM_001107514 Rosetta Predictions rat pricing
NM_001033432 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081740 predicted 1228
2 SASI_Hs02_00349072 predicted 1925
3 SASI_Hs01_00081741 predicted 1917
4 SASI_Hs01_00081742 predicted 1551
5 SASI_Hs01_00081743 predicted 1801
6 SASI_Hs01_00081744 predicted 852
7 SASI_Hs01_00081746 predicted 1410
8 SASI_Hs01_00081747 predicted 1564
9 SASI_Hs01_00081748 predicted 1523
10 SASI_Hs02_00349073 predicted 1449
11 SASI_Hs01_00081739 predicted 1983
12 SASI_Hs01_00081745 predicted 1984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107514 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229575 predicted 1292
2 SASI_Rn02_00229576 predicted 878
3 SASI_Rn02_00229577 predicted 962
4 SASI_Rn02_00229578 predicted 826
5 SASI_Rn02_00229579 predicted 908
6 SASI_Rn02_00229580 predicted 852
7 SASI_Rn02_00229581 predicted 797
8 SASI_Rn02_00229582 predicted 487
9 SASI_Rn02_00229583 predicted 836
10 SASI_Rn02_00229584 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033432 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175615 predicted 1553
2 SASI_Mm01_00175616 predicted 1384
3 SASI_Mm02_00288743 predicted 1922
4 SASI_Mm01_00175617 predicted 1239
5 SASI_Mm01_00175618 predicted 1464
6 SASI_Mm02_00288744 predicted 1418
7 SASI_Mm01_00175619 predicted 1921
8 SASI_Mm01_00175620 predicted 1398
9 SASI_Mm01_00175621 predicted 1359
10 SASI_Mm01_00175622 predicted 1645
11 SASI_Mm01_00175623 predicted 1989
12 SASI_Mm01_00175624 predicted 1716
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016217
VALIDATED
HECA MISSION shRNA Bacterial Glycerol Stock
headcase homolog (Drosophila)
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016217.2-1417s21c1
Sequence:CCGGGAAGACTTGCGGAAGTTCATTCTCGAGAATGAACTTCCGCAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016217.2-2075s21c1
Sequence:CCGGGTCTTGATTCCCGAGTGTTAACTCGAGTTAACACTCGGGAATCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016217.2-1555s21c1
Sequence:CCGGAGACATGATGAGATCGAATATCTCGAGATATTCGATCTCATCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016217.2-1806s21c1
Sequence:CCGGGATGCAGTACTTCTCCGAATACTCGAGTATTCGGAGAAGTACTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016217.2-765s21c1
Sequence:CCGGCCAGAACATGTGGACAAAGAACTCGAGTTCTTTGTCCACATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1821s1c1
Sequence:CCGGCGAATATAGCAACGTCCAGCACTCGAGTGCTGGACGTTGCTATATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1866s1c1
Sequence:CCGGCTACCACTTCGTGAAGCCATTCTCGAGAATGGCTTCACGAAGTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1661s1c1
Sequence:CCGGGCATCAAGTGTAAGTCACGGTCTCGAGACCGTGACTTACACTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-771s1c1
Sequence:CCGGCATGTGGACAAAGAAGGGCTACTCGAGTAGCCCTTCTTTGTCCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-765s1c1
Sequence:CCGGCCAGAACATGTGGACAAAGAACTCGAGTTCTTTGTCCACATGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1355s1c1
Sequence:CCGGCCAGGCATAAGCTGAACACTTCTCGAGAAGTGTTCAGCTTATGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1359s1c1
Sequence:CCGGGCATAAGCTGAACACTTTCCACTCGAGTGGAAAGTGTTCAGCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1173s1c1
Sequence:CCGGGTTCTTAAAGAACGCCATCCACTCGAGTGGATGGCGTTCTTTAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1561s1c1
Sequence:CCGGGATGAGATCGAATATGATGTTCTCGAGAACATCATATTCGATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016217.1-1553s1c1
Sequence:CCGGCGAGACATGATGAGATCGAATCTCGAGATTCGATCTCATCATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1806s1c1
Sequence:CCGGGATGCAGTACTTCTCCGAATACTCGAGTATTCGGAGAAGTACTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016217.1-1417s1c1
Sequence:CCGGGAAGACTTGCGGAAGTTCATTCTCGAGAATGAACTTCCGCAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016217
VALIDATED
HECA MISSION shRNA shRNA Plasmid DNA
headcase homolog (Drosophila)
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016217.2-1417s21c1
Sequence:CCGGGAAGACTTGCGGAAGTTCATTCTCGAGAATGAACTTCCGCAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016217.2-2075s21c1
Sequence:CCGGGTCTTGATTCCCGAGTGTTAACTCGAGTTAACACTCGGGAATCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016217.2-1555s21c1
Sequence:CCGGAGACATGATGAGATCGAATATCTCGAGATATTCGATCTCATCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016217.2-1806s21c1
Sequence:CCGGGATGCAGTACTTCTCCGAATACTCGAGTATTCGGAGAAGTACTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016217.2-765s21c1
Sequence:CCGGCCAGAACATGTGGACAAAGAACTCGAGTTCTTTGTCCACATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1821s1c1
Sequence:CCGGCGAATATAGCAACGTCCAGCACTCGAGTGCTGGACGTTGCTATATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1866s1c1
Sequence:CCGGCTACCACTTCGTGAAGCCATTCTCGAGAATGGCTTCACGAAGTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1661s1c1
Sequence:CCGGGCATCAAGTGTAAGTCACGGTCTCGAGACCGTGACTTACACTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-771s1c1
Sequence:CCGGCATGTGGACAAAGAAGGGCTACTCGAGTAGCCCTTCTTTGTCCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-765s1c1
Sequence:CCGGCCAGAACATGTGGACAAAGAACTCGAGTTCTTTGTCCACATGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1355s1c1
Sequence:CCGGCCAGGCATAAGCTGAACACTTCTCGAGAAGTGTTCAGCTTATGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1359s1c1
Sequence:CCGGGCATAAGCTGAACACTTTCCACTCGAGTGGAAAGTGTTCAGCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1173s1c1
Sequence:CCGGGTTCTTAAAGAACGCCATCCACTCGAGTGGATGGCGTTCTTTAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1561s1c1
Sequence:CCGGGATGAGATCGAATATGATGTTCTCGAGAACATCATATTCGATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016217.1-1553s1c1
Sequence:CCGGCGAGACATGATGAGATCGAATCTCGAGATTCGATCTCATCATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1806s1c1
Sequence:CCGGGATGCAGTACTTCTCCGAATACTCGAGTATTCGGAGAAGTACTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016217.1-1417s1c1
Sequence:CCGGGAAGACTTGCGGAAGTTCATTCTCGAGAATGAACTTCCGCAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016217
VALIDATED
HECA MISSION shRNA Lentiviral Transduction Particles
headcase homolog (Drosophila)
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016217.2-1417s21c1
Sequence:CCGGGAAGACTTGCGGAAGTTCATTCTCGAGAATGAACTTCCGCAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016217.2-2075s21c1
Sequence:CCGGGTCTTGATTCCCGAGTGTTAACTCGAGTTAACACTCGGGAATCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016217.2-1555s21c1
Sequence:CCGGAGACATGATGAGATCGAATATCTCGAGATATTCGATCTCATCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016217.2-1806s21c1
Sequence:CCGGGATGCAGTACTTCTCCGAATACTCGAGTATTCGGAGAAGTACTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016217.2-765s21c1
Sequence:CCGGCCAGAACATGTGGACAAAGAACTCGAGTTCTTTGTCCACATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1821s1c1
Sequence:CCGGCGAATATAGCAACGTCCAGCACTCGAGTGCTGGACGTTGCTATATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1866s1c1
Sequence:CCGGCTACCACTTCGTGAAGCCATTCTCGAGAATGGCTTCACGAAGTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1661s1c1
Sequence:CCGGGCATCAAGTGTAAGTCACGGTCTCGAGACCGTGACTTACACTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-771s1c1
Sequence:CCGGCATGTGGACAAAGAAGGGCTACTCGAGTAGCCCTTCTTTGTCCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-765s1c1
Sequence:CCGGCCAGAACATGTGGACAAAGAACTCGAGTTCTTTGTCCACATGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1355s1c1
Sequence:CCGGCCAGGCATAAGCTGAACACTTCTCGAGAAGTGTTCAGCTTATGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1359s1c1
Sequence:CCGGGCATAAGCTGAACACTTTCCACTCGAGTGGAAAGTGTTCAGCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1173s1c1
Sequence:CCGGGTTCTTAAAGAACGCCATCCACTCGAGTGGATGGCGTTCTTTAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1561s1c1
Sequence:CCGGGATGAGATCGAATATGATGTTCTCGAGAACATCATATTCGATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016217.1-1553s1c1
Sequence:CCGGCGAGACATGATGAGATCGAATCTCGAGATTCGATCTCATCATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016217.1-1806s1c1
Sequence:CCGGGATGCAGTACTTCTCCGAATACTCGAGTATTCGGAGAAGTACTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016217.1-1417s1c1
Sequence:CCGGGAAGACTTGCGGAAGTTCATTCTCGAGAATGAACTTCCGCAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033432
VALIDATED
HECA MISSION shRNA Bacterial Glycerol Stock
headcase homolog (Drosophila)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000251134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033432.3-1360s21c1
Sequence:CCGGAGGCATAAGCTAAACACTTTCCTCGAGGAAAGTGTTTAGCTTATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033432.3-1558s21c1
Sequence:CCGGAGACACGATGAGATTGAATATCTCGAGATATTCAATCTCATCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033432.3-3324s21c1
Sequence:CCGGGCATTAAGGAACCCAACTAAACTCGAGTTTAGTTGGGTTCCTTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033432.3-1858s21c1
Sequence:CCGGGGGAACCTGGACTACCATTTCCTCGAGGAAATGGTAGTCCAGGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033432
VALIDATED
HECA MISSION shRNA shRNA Plasmid DNA
headcase homolog (Drosophila)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000251134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033432.3-1360s21c1
Sequence:CCGGAGGCATAAGCTAAACACTTTCCTCGAGGAAAGTGTTTAGCTTATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033432.3-1558s21c1
Sequence:CCGGAGACACGATGAGATTGAATATCTCGAGATATTCAATCTCATCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033432.3-3324s21c1
Sequence:CCGGGCATTAAGGAACCCAACTAAACTCGAGTTTAGTTGGGTTCCTTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033432.3-1858s21c1
Sequence:CCGGGGGAACCTGGACTACCATTTCCTCGAGGAAATGGTAGTCCAGGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033432
VALIDATED
HECA MISSION shRNA Lentiviral Transduction Particles
headcase homolog (Drosophila)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000251134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033432.3-1360s21c1
Sequence:CCGGAGGCATAAGCTAAACACTTTCCTCGAGGAAAGTGTTTAGCTTATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033432.3-1558s21c1
Sequence:CCGGAGACACGATGAGATTGAATATCTCGAGATATTCAATCTCATCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033432.3-3324s21c1
Sequence:CCGGGCATTAAGGAACCCAACTAAACTCGAGTTTAGTTGGGTTCCTTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033432.3-1858s21c1
Sequence:CCGGGGGAACCTGGACTACCATTTCCTCGAGGAAATGGTAGTCCAGGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks