EMAIL THIS PAGE TO A FRIEND

HEG1

heart development protein with EGF-like domains 1

Synonyms: HEG MST112 MSTP112
UniProtKB ID: Q9ULI3, Q6NX66, Q8NC40, Q9BSV0
Gene ID:
Mouse(77446) HEG homolog 1 (zebrafish)
Rat(689710) heart development protein with EGF-like domains 1
chicken(424257) HEG homolog 1 (zebrafish)
Horse(100070351) HEG homolog 1 (zebrafish)
domestic cat(101080319) HEG homolog 1 (zebrafish)
dog(488015) HEG homolog 1 (zebrafish)
cow(511689) heart development protein with EGF-like domains 1
domestic guinea pig(100712800) heart development protein with EGF-like domains 1
naked mole-rat(101722699) heart development protein with EGF-like domains 1
sheep(101121656) HEG homolog 1 (zebrafish)
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_172934 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172934 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172934 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020733 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020733 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020733 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020733 Rosetta Predictions human pricing
XM_087386 Rosetta Predictions human pricing
XM_001071742 Rosetta Predictions rat pricing
NM_172934 Rosetta Predictions mouse pricing
NM_175256 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353816 predicted 1797
2 SASI_Hs02_00353817 predicted 2916
3 SASI_Hs02_00353818 predicted 3182
4 SASI_Hs02_00353819 predicted 3516
5 SASI_Hs02_00353820 predicted 1048
6 SASI_Hs02_00353821 predicted 4151
7 SASI_Hs02_00353822 predicted 3757
8 SASI_Hs02_00353823 predicted 3870
9 SASI_Hs02_00353824 predicted 1065
10 SASI_Hs02_00353825 predicted 3799
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_087386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265764 predicted 1798
2 SASI_Hs01_00265765 predicted 4194
3 SASI_Hs01_00265766 predicted 2218
4 SASI_Hs01_00265767 predicted 2585
5 SASI_Hs01_00265768 predicted 3183
6 SASI_Hs01_00265769 predicted 3518
7 SASI_Hs01_00265770 predicted 1042
8 SASI_Hs01_00265771 predicted 2217
9 SASI_Hs01_00265772 predicted 3765
10 SASI_Hs01_00265773 predicted 3440
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336296 predicted 431
2 SASI_Rn02_00336297 predicted 435
3 SASI_Rn02_00336298 predicted 503
4 SASI_Rn02_00336299 predicted 530
5 SASI_Rn02_00336300 predicted 14
6 SASI_Rn02_00336301 predicted 416
7 SASI_Rn02_00336302 predicted 523
8 SASI_Rn02_00336303 predicted 439
9 SASI_Rn02_00336304 predicted 330
10 SASI_Rn02_00336305 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172934 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151414 predicted 863
2 SASI_Mm01_00151415 predicted 1412
3 SASI_Mm01_00151416 predicted 1003
4 SASI_Mm01_00151417 predicted 767
5 SASI_Mm01_00151418 predicted 1054
6 SASI_Mm01_00151419 predicted 1304
7 SASI_Mm01_00151420 predicted 991
8 SASI_Mm01_00151421 predicted 929
9 SASI_Mm01_00151422 predicted 1169
10 SASI_Mm01_00151423 predicted 1398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070523 predicted 3179
2 SASI_Mm01_00070524 predicted 1529
3 SASI_Mm01_00070525 predicted 1650
4 SASI_Mm01_00070527 predicted 2421
5 SASI_Mm01_00070528 predicted 1894
6 SASI_Mm01_00070529 predicted 2582
7 SASI_Mm01_00070530 predicted 2928
8 SASI_Mm01_00070531 predicted 2699
9 SASI_Mm01_00070532 predicted 2204
10 SASI_Mm02_00345963 predicted 2947
11 SASI_Mm01_00070526 predicted 988
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175256
HEG1 MISSION shRNA Bacterial Glycerol Stock
heart development protein with EGF-like domains 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175256.4-3101s1c1
Sequence:CCGGCGTGCTCATTTCCAAGCCAATCTCGAGATTGGCTTGGAAATGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175256.4-807s1c1
Sequence:CCGGCGGCAATATCAGCCATTGCATCTCGAGATGCAATGGCTGATATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175256.4-2149s1c1
Sequence:CCGGCCAGTTCAACAAGATGGATCACTCGAGTGATCCATCTTGTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175256.4-2177s1c1
Sequence:CCGGCGAGCATGTGAAGATGGATATCTCGAGATATCCATCTTCACATGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175256.4-2616s1c1
Sequence:CCGGCGGGACAGTATAACCCATCTTCTCGAGAAGATGGGTTATACTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175256.5-1204s1c1
Sequence:CCGGCCTACACGTCCACTGTTAATACTCGAGTATTAACAGTGGACGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175256.5-4313s1c1
Sequence:CCGGCCAATCTTCCAAACCATAATGCTCGAGCATTATGGTTTGGAAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175256
HEG1 MISSION shRNA shRNA Plasmid DNA
heart development protein with EGF-like domains 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175256.4-3101s1c1
Sequence:CCGGCGTGCTCATTTCCAAGCCAATCTCGAGATTGGCTTGGAAATGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175256.4-807s1c1
Sequence:CCGGCGGCAATATCAGCCATTGCATCTCGAGATGCAATGGCTGATATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175256.4-2149s1c1
Sequence:CCGGCCAGTTCAACAAGATGGATCACTCGAGTGATCCATCTTGTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175256.4-2177s1c1
Sequence:CCGGCGAGCATGTGAAGATGGATATCTCGAGATATCCATCTTCACATGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175256.4-2616s1c1
Sequence:CCGGCGGGACAGTATAACCCATCTTCTCGAGAAGATGGGTTATACTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175256.5-1204s1c1
Sequence:CCGGCCTACACGTCCACTGTTAATACTCGAGTATTAACAGTGGACGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175256.5-4313s1c1
Sequence:CCGGCCAATCTTCCAAACCATAATGCTCGAGCATTATGGTTTGGAAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175256
HEG1 MISSION shRNA Lentiviral Transduction Particles
heart development protein with EGF-like domains 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175256.4-3101s1c1
Sequence:CCGGCGTGCTCATTTCCAAGCCAATCTCGAGATTGGCTTGGAAATGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175256.4-807s1c1
Sequence:CCGGCGGCAATATCAGCCATTGCATCTCGAGATGCAATGGCTGATATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175256.4-2149s1c1
Sequence:CCGGCCAGTTCAACAAGATGGATCACTCGAGTGATCCATCTTGTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175256.4-2177s1c1
Sequence:CCGGCGAGCATGTGAAGATGGATATCTCGAGATATCCATCTTCACATGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175256.4-2616s1c1
Sequence:CCGGCGGGACAGTATAACCCATCTTCTCGAGAAGATGGGTTATACTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175256.5-1204s1c1
Sequence:CCGGCCTACACGTCCACTGTTAATACTCGAGTATTAACAGTGGACGTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175256.5-4313s1c1
Sequence:CCGGCCAATCTTCCAAACCATAATGCTCGAGCATTATGGTTTGGAAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172934
HEG1 MISSION shRNA Bacterial Glycerol Stock
heart development protein with EGF-like domains 1
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000200710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172934.1-1571s1c1
Sequence:CCGGGCCATTATTCTCTTAGCTGATCTCGAGATCAGCTAAGAGAATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172934.1-431s1c1
Sequence:CCGGCACAAAGAAGAATCACACCTTCTCGAGAAGGTGTGATTCTTCTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172934
HEG1 MISSION shRNA shRNA Plasmid DNA
heart development protein with EGF-like domains 1
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000200710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172934.1-1571s1c1
Sequence:CCGGGCCATTATTCTCTTAGCTGATCTCGAGATCAGCTAAGAGAATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172934.1-431s1c1
Sequence:CCGGCACAAAGAAGAATCACACCTTCTCGAGAAGGTGTGATTCTTCTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172934
HEG1 MISSION shRNA Lentiviral Transduction Particles
heart development protein with EGF-like domains 1
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000200710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172934.1-1571s1c1
Sequence:CCGGGCCATTATTCTCTTAGCTGATCTCGAGATCAGCTAAGAGAATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172934.1-431s1c1
Sequence:CCGGCACAAAGAAGAATCACACCTTCTCGAGAAGGTGTGATTCTTCTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020733
VALIDATED
HEG1 MISSION shRNA Bacterial Glycerol Stock
heart development protein with EGF-like domains 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020733.1-6404s21c1
Sequence:CCGGTTCCGTATGGAGTGGATTAAGCTCGAGCTTAATCCACTCCATACGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020733.1-3719s21c1
Sequence:CCGGAGCATGTGAAGATGGATATAGCTCGAGCTATATCCATCTTCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020733.1-3267s21c1
Sequence:CCGGACCTTCGTGACAGAGTTTAAACTCGAGTTTAAACTCTGTCACGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020733.1-1570s21c1
Sequence:CCGGCATTGGGAGATAGGAGTTATTCTCGAGAATAACTCCTATCTCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020733.1-3562s21c1
Sequence:CCGGGATCTCAGAGGCGGATCTTTACTCGAGTAAAGATCCGCCTCTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020733
VALIDATED
HEG1 MISSION shRNA shRNA Plasmid DNA
heart development protein with EGF-like domains 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020733.1-6404s21c1
Sequence:CCGGTTCCGTATGGAGTGGATTAAGCTCGAGCTTAATCCACTCCATACGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020733.1-3719s21c1
Sequence:CCGGAGCATGTGAAGATGGATATAGCTCGAGCTATATCCATCTTCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020733.1-3267s21c1
Sequence:CCGGACCTTCGTGACAGAGTTTAAACTCGAGTTTAAACTCTGTCACGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020733.1-1570s21c1
Sequence:CCGGCATTGGGAGATAGGAGTTATTCTCGAGAATAACTCCTATCTCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020733.1-3562s21c1
Sequence:CCGGGATCTCAGAGGCGGATCTTTACTCGAGTAAAGATCCGCCTCTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020733
VALIDATED
HEG1 MISSION shRNA Lentiviral Transduction Particles
heart development protein with EGF-like domains 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020733.1-6404s21c1
Sequence:CCGGTTCCGTATGGAGTGGATTAAGCTCGAGCTTAATCCACTCCATACGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020733.1-3719s21c1
Sequence:CCGGAGCATGTGAAGATGGATATAGCTCGAGCTATATCCATCTTCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020733.1-3267s21c1
Sequence:CCGGACCTTCGTGACAGAGTTTAAACTCGAGTTTAAACTCTGTCACGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020733.1-1570s21c1
Sequence:CCGGCATTGGGAGATAGGAGTTATTCTCGAGAATAACTCCTATCTCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020733.1-3562s21c1
Sequence:CCGGGATCTCAGAGGCGGATCTTTACTCGAGTAAAGATCCGCCTCTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks