EMAIL THIS PAGE TO A FRIEND

HEPHL1

hephaestin-like 1

UniProtKB ID: Q6MZM0, Q3C1W7
Gene ID:
Mouse(244698) hephaestin-like 1
Rat(500946) hephaestin-like 1
sheep(101118648) hephaestin-like 1
domestic guinea pig(100716354) hephaestin-like 1
naked mole-rat(101708132) hephaestin-like 1
Zebrafish(561607) hephaestin-like 1
chicken(418998) hephaestin-like 1
Horse(100058293) hephaestin-like 1
cow(519580) hephaestin-like 1
domestic cat(101081920) hephaestin-like 1
dog(485127) hephaestin-like 1
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001164797 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001164797 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001164797 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001098672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098672 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098672 Rosetta Predictions human pricing
XM_291947 Rosetta Predictions human pricing
XM_001074431 Rosetta Predictions rat pricing
XM_576357 Rosetta Predictions rat pricing
XM_146812 Rosetta Predictions mouse pricing
XM_986515 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319711 predicted 315
2 SASI_Hs02_00319712 predicted 3442
3 SASI_Hs02_00319713 predicted 3526
4 SASI_Hs02_00319714 predicted 553
5 SASI_Hs02_00319715 predicted 3101
6 SASI_Hs02_00319716 predicted 226
7 SASI_Hs02_00319717 predicted 402
8 SASI_Hs02_00319718 predicted 3566
9 SASI_Hs02_00319719 predicted 1281
10 SASI_Hs02_00319720 predicted 2849
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_291947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249599 predicted 581
2 SASI_Hs01_00249600 predicted 3671
3 SASI_Hs01_00249601 predicted 1588
4 SASI_Hs01_00249602 predicted 3766
5 SASI_Hs01_00249603 predicted 3337
6 SASI_Hs01_00249604 predicted 493
7 SASI_Hs01_00249605 predicted 674
8 SASI_Hs01_00249606 predicted 3810
9 SASI_Hs01_00249607 predicted 3746
10 SASI_Hs01_00249608 predicted 1549
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074431 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346216 predicted 2253
2 SASI_Rn02_00346217 predicted 1490
3 SASI_Rn02_00346218 predicted 449
4 SASI_Rn02_00346219 predicted 1830
5 SASI_Rn02_00346220 predicted 711
6 SASI_Rn02_00346221 predicted 1890
7 SASI_Rn02_00346222 predicted 638
8 SASI_Rn02_00346223 predicted 1568
9 SASI_Rn02_00346224 predicted 758
10 SASI_Rn02_00346225 predicted 1457
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576357 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405141 predicted 2283
2 SASI_Rn02_00405142 predicted 1510
3 SASI_Rn02_00405143 predicted 477
4 SASI_Rn02_00405144 predicted 1863
5 SASI_Rn02_00405145 predicted 740
6 SASI_Rn02_00405146 predicted 2846
7 SASI_Rn02_00405147 predicted 1914
8 SASI_Rn02_00405148 predicted 660
9 SASI_Rn02_00405149 predicted 339
10 SASI_Rn02_00405150 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_146812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425316 predicted 2277
2 SASI_Mm02_00425317 predicted 2371
3 SASI_Mm02_00425318 predicted 2344
4 SASI_Mm02_00425319 predicted 2982
5 SASI_Mm01_00240519 predicted 1130
6 SASI_Mm02_00425320 predicted 1864
7 SASI_Mm02_00425321 predicted 2947
8 SASI_Mm01_00240524 predicted 989
9 SASI_Mm01_00240525 predicted 1095
10 SASI_Mm01_00240526 predicted 1425
11 SASI_Mm01_00240517 predicted 489
12 SASI_Mm01_00240518 predicted 416
13 SASI_Mm01_00240520 predicted 374
14 SASI_Mm01_00240521 predicted 1301
15 SASI_Mm01_00240522 predicted 786
16 SASI_Mm01_00240523 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00449098 predicted 406
2 SASI_Mm02_00449099 predicted 2283
3 SASI_Mm02_00449100 predicted 2374
4 SASI_Mm02_00449101 predicted 1371
5 SASI_Mm02_00449102 predicted 2978
6 SASI_Mm02_00449103 predicted 1135
7 SASI_Mm02_00449104 predicted 1862
8 SASI_Mm02_00449105 predicted 786
9 SASI_Mm02_00449106 predicted 734
10 SASI_Mm02_00449107 predicted 790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164797
HEPHL1 MISSION shRNA Bacterial Glycerol Stock
hephaestin-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164797.1-1600s21c1
Sequence:CCGGCCCGTGCCTGACCTATCTTTACTCGAGTAAAGATAGGTCAGGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164797.1-219s21c1
Sequence:CCGGTCTACAAGAAGGCGGTTTATACTCGAGTATAAACCGCCTTCTTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164797.1-3673s21c1
Sequence:CCGGTGAATGATTCTCAGGTATAAACTCGAGTTTATACCTGAGAATCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164797.1-585s21c1
Sequence:CCGGATATCTGCTCTGGGCTAATTGCTCGAGCAATTAGCCCAGAGCAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164797.1-660s21c1
Sequence:CCGGCTGATGTGGACCGAGAGTTTGCTCGAGCAAACTCTCGGTCCACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164797
HEPHL1 MISSION shRNA shRNA Plasmid DNA
hephaestin-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164797.1-1600s21c1
Sequence:CCGGCCCGTGCCTGACCTATCTTTACTCGAGTAAAGATAGGTCAGGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164797.1-219s21c1
Sequence:CCGGTCTACAAGAAGGCGGTTTATACTCGAGTATAAACCGCCTTCTTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164797.1-3673s21c1
Sequence:CCGGTGAATGATTCTCAGGTATAAACTCGAGTTTATACCTGAGAATCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164797.1-585s21c1
Sequence:CCGGATATCTGCTCTGGGCTAATTGCTCGAGCAATTAGCCCAGAGCAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164797.1-660s21c1
Sequence:CCGGCTGATGTGGACCGAGAGTTTGCTCGAGCAAACTCTCGGTCCACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164797
HEPHL1 MISSION shRNA Lentiviral Transduction Particles
hephaestin-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164797.1-1600s21c1
Sequence:CCGGCCCGTGCCTGACCTATCTTTACTCGAGTAAAGATAGGTCAGGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164797.1-219s21c1
Sequence:CCGGTCTACAAGAAGGCGGTTTATACTCGAGTATAAACCGCCTTCTTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164797.1-3673s21c1
Sequence:CCGGTGAATGATTCTCAGGTATAAACTCGAGTTTATACCTGAGAATCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164797.1-585s21c1
Sequence:CCGGATATCTGCTCTGGGCTAATTGCTCGAGCAATTAGCCCAGAGCAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164797.1-660s21c1
Sequence:CCGGCTGATGTGGACCGAGAGTTTGCTCGAGCAAACTCTCGGTCCACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098672
HEPHL1 MISSION shRNA Bacterial Glycerol Stock
hephaestin-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098672.1-1334s21c1
Sequence:CCGGTATGCTCCTCAAGGCTATAACCTCGAGGTTATAGCCTTGAGGAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098672.1-2617s21c1
Sequence:CCGGCAACACCGTCCTGATCATATTCTCGAGAATATGATCAGGACGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098672.1-1587s21c1
Sequence:CCGGCCGACAAGGTCTATAGCATTTCTCGAGAAATGCTATAGACCTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098672.1-3825s21c1
Sequence:CCGGCGAATAATCCTCAGGTATAAACTCGAGTTTATACCTGAGGATTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098672.1-741s21c1
Sequence:CCGGACATCTGCTCTGGGCTAATTGCTCGAGCAATTAGCCCAGAGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098672
HEPHL1 MISSION shRNA shRNA Plasmid DNA
hephaestin-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098672.1-1334s21c1
Sequence:CCGGTATGCTCCTCAAGGCTATAACCTCGAGGTTATAGCCTTGAGGAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098672.1-2617s21c1
Sequence:CCGGCAACACCGTCCTGATCATATTCTCGAGAATATGATCAGGACGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098672.1-1587s21c1
Sequence:CCGGCCGACAAGGTCTATAGCATTTCTCGAGAAATGCTATAGACCTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098672.1-3825s21c1
Sequence:CCGGCGAATAATCCTCAGGTATAAACTCGAGTTTATACCTGAGGATTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098672.1-741s21c1
Sequence:CCGGACATCTGCTCTGGGCTAATTGCTCGAGCAATTAGCCCAGAGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098672
HEPHL1 MISSION shRNA Lentiviral Transduction Particles
hephaestin-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098672.1-1334s21c1
Sequence:CCGGTATGCTCCTCAAGGCTATAACCTCGAGGTTATAGCCTTGAGGAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098672.1-2617s21c1
Sequence:CCGGCAACACCGTCCTGATCATATTCTCGAGAATATGATCAGGACGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098672.1-1587s21c1
Sequence:CCGGCCGACAAGGTCTATAGCATTTCTCGAGAAATGCTATAGACCTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098672.1-3825s21c1
Sequence:CCGGCGAATAATCCTCAGGTATAAACTCGAGTTTATACCTGAGGATTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098672.1-741s21c1
Sequence:CCGGACATCTGCTCTGGGCTAATTGCTCGAGCAATTAGCCCAGAGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks