EMAIL THIS PAGE TO A FRIEND

HERC3

HECT and RLD domain containing E3 ubiquitin protein ligase 3

UniProtKB ID: Q15034, A8K1S5
Gene ID:
Human(8916) Summary: This gene encodes a member the HERC ubiquitin ligase family. The encoded protein is located in the cytosol and binds ubiquitin via a HECT domain. Mutations in this gene have been associated with colorectal and gastric carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
Mouse(73998) hect domain and RLD 3
Rat(362377) HECT and RLD domain containing E3 ubiquitin protein ligase 3
Zebrafish(100003587) hect domain and RLD 3
chicken(422514) hect domain and RLD 3
dog(478475) HECT and RLD domain containing E3 ubiquitin protein ligase 3
domestic cat(101092849) HECT and RLD domain containing E3 ubiquitin protein ligase 3
cow(510924) HECT and RLD domain containing E3 ubiquitin protein ligase 3
Horse(100053167) HECT and RLD domain containing E3 ubiquitin protein ligase 3
domestic guinea pig(100724559) HECT and RLD domain containing E3 ubiquitin protein ligase 3
naked mole-rat(101726754) HECT and RLD domain containing E3 ubiquitin protein ligase 3
sheep(101118611) HECT and RLD domain containing E3 ubiquitin protein ligase 3
163 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028705 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028705 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028705 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014606 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014606 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014606 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014606 Rosetta Predictions human pricing
NM_001108631 Rosetta Predictions rat pricing
XM_342701 Rosetta Predictions rat pricing
NM_028705 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223203 predicted 1890
2 SASI_Hs01_00223204 predicted 2285
3 SASI_Hs01_00223205 predicted 3004
4 SASI_Hs01_00223206 predicted 994
5 SASI_Hs01_00223207 predicted 3344
6 SASI_Hs01_00223208 predicted 3410
7 SASI_Hs02_00345890 predicted 1930
8 SASI_Hs01_00223209 predicted 2521
9 SASI_Hs01_00223210 predicted 935
10 SASI_Hs01_00223212 predicted 2601
11 SASI_Hs01_00223211 predicted 2949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108631 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240529 predicted 2900
2 SASI_Rn02_00240530 predicted 3438
3 SASI_Rn02_00240531 predicted 3028
4 SASI_Rn02_00240532 predicted 2961
5 SASI_Rn02_00240533 predicted 3788
6 SASI_Rn02_00240534 predicted 1319
7 SASI_Rn02_00240535 predicted 2766
8 SASI_Rn02_00240536 predicted 1503
9 SASI_Rn02_00240537 predicted 2953
10 SASI_Rn02_00240538 predicted 2497
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00156654 predicted 2959
2 SASI_Rn01_00156655 predicted 2546
3 SASI_Rn01_00156656 predicted 2490
4 SASI_Rn01_00156657 predicted 1845
5 SASI_Rn01_00156658 predicted 3313
6 SASI_Rn01_00156659 predicted 837
7 SASI_Rn01_00156660 predicted 2289
8 SASI_Rn01_00156661 predicted 2474
9 SASI_Rn01_00156662 predicted 1095
10 SASI_Rn01_00156663 predicted 2019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028013 predicted 2384
2 SASI_Mm01_00028014 predicted 2534
3 SASI_Mm01_00028015 predicted 2474
4 SASI_Mm01_00028016 predicted 2257
5 SASI_Mm01_00028017 predicted 2402
6 SASI_Mm01_00028019 predicted 2277
7 SASI_Mm02_00334241 predicted 919
8 SASI_Mm01_00028020 predicted 1011
9 SASI_Mm01_00028021 predicted 2456
10 SASI_Mm01_00028022 predicted 820
11 SASI_Mm01_00028018 predicted 2792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028705
HERC3 MISSION shRNA Bacterial Glycerol Stock
HECT and RLD domain containing E3 ubiquitin protein ligase 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000041014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028705.2-3233s1c1
Sequence:CCGGCCTCGACAACTATGAGGGTTTCTCGAGAAACCCTCATAGTTGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028705.2-1850s1c1
Sequence:CCGGCCCGGTACTGTTTAACAACTACTCGAGTAGTTGTTAAACAGTACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028705.2-1186s1c1
Sequence:CCGGGCTTTAAGTATCGTGTCGTTACTCGAGTAACGACACGATACTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028705.2-2786s1c1
Sequence:CCGGCGCTTATGTGAATTACATCTTCTCGAGAAGATGTAATTCACATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028705
HERC3 MISSION shRNA shRNA Plasmid DNA
HECT and RLD domain containing E3 ubiquitin protein ligase 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000041014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028705.2-3233s1c1
Sequence:CCGGCCTCGACAACTATGAGGGTTTCTCGAGAAACCCTCATAGTTGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028705.2-1850s1c1
Sequence:CCGGCCCGGTACTGTTTAACAACTACTCGAGTAGTTGTTAAACAGTACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028705.2-1186s1c1
Sequence:CCGGGCTTTAAGTATCGTGTCGTTACTCGAGTAACGACACGATACTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028705.2-2786s1c1
Sequence:CCGGCGCTTATGTGAATTACATCTTCTCGAGAAGATGTAATTCACATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028705
HERC3 MISSION shRNA Lentiviral Transduction Particles
HECT and RLD domain containing E3 ubiquitin protein ligase 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000041014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028705.2-3233s1c1
Sequence:CCGGCCTCGACAACTATGAGGGTTTCTCGAGAAACCCTCATAGTTGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028705.2-1850s1c1
Sequence:CCGGCCCGGTACTGTTTAACAACTACTCGAGTAGTTGTTAAACAGTACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028705.2-1186s1c1
Sequence:CCGGGCTTTAAGTATCGTGTCGTTACTCGAGTAACGACACGATACTTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028705.2-2786s1c1
Sequence:CCGGCGCTTATGTGAATTACATCTTCTCGAGAAGATGTAATTCACATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014606
HERC3 MISSION shRNA Bacterial Glycerol Stock
HECT and RLD domain containing E3 ubiquitin protein ligase 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000291    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014606.x-3454s1c1
Sequence:CCGGGATGTGTTTCTGGGATTGTATCTCGAGATACAATCCCAGAAACACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014606.x-2812s1c1
Sequence:CCGGCAAGGATAACAGGCAGGAATTCTCGAGAATTCCTGCCTGTTATCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014606.x-1556s1c1
Sequence:CCGGAGGGTGTTATTTGAGAAGTTACTCGAGTAACTTCTCAAATAACACCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014606.x-1348s1c1
Sequence:CCGGCCAAGCACATTATACCAGTTTCTCGAGAAACTGGTATAATGTGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014606.x-2747s1c1
Sequence:CCGGCGAGAAAGCTATGGAGTGATTCTCGAGAATCACTCCATAGCTTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014606.1-1127s21c1
Sequence:CCGGTGTGGAGCAAGAGGTCAATTACTCGAGTAATTGACCTCTTGCTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014606.1-1226s21c1
Sequence:CCGGGCCCGAGCTGATCGCTTTAAACTCGAGTTTAAAGCGATCAGCTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014606
HERC3 MISSION shRNA shRNA Plasmid DNA
HECT and RLD domain containing E3 ubiquitin protein ligase 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000291    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014606.x-3454s1c1
Sequence:CCGGGATGTGTTTCTGGGATTGTATCTCGAGATACAATCCCAGAAACACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014606.x-2812s1c1
Sequence:CCGGCAAGGATAACAGGCAGGAATTCTCGAGAATTCCTGCCTGTTATCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014606.x-1556s1c1
Sequence:CCGGAGGGTGTTATTTGAGAAGTTACTCGAGTAACTTCTCAAATAACACCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014606.x-1348s1c1
Sequence:CCGGCCAAGCACATTATACCAGTTTCTCGAGAAACTGGTATAATGTGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014606.x-2747s1c1
Sequence:CCGGCGAGAAAGCTATGGAGTGATTCTCGAGAATCACTCCATAGCTTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014606.1-1127s21c1
Sequence:CCGGTGTGGAGCAAGAGGTCAATTACTCGAGTAATTGACCTCTTGCTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014606.1-1226s21c1
Sequence:CCGGGCCCGAGCTGATCGCTTTAAACTCGAGTTTAAAGCGATCAGCTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014606
HERC3 MISSION shRNA Lentiviral Transduction Particles
HECT and RLD domain containing E3 ubiquitin protein ligase 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000291    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014606.x-3454s1c1
Sequence:CCGGGATGTGTTTCTGGGATTGTATCTCGAGATACAATCCCAGAAACACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014606.x-2812s1c1
Sequence:CCGGCAAGGATAACAGGCAGGAATTCTCGAGAATTCCTGCCTGTTATCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014606.x-1556s1c1
Sequence:CCGGAGGGTGTTATTTGAGAAGTTACTCGAGTAACTTCTCAAATAACACCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014606.x-1348s1c1
Sequence:CCGGCCAAGCACATTATACCAGTTTCTCGAGAAACTGGTATAATGTGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014606.x-2747s1c1
Sequence:CCGGCGAGAAAGCTATGGAGTGATTCTCGAGAATCACTCCATAGCTTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014606.1-1127s21c1
Sequence:CCGGTGTGGAGCAAGAGGTCAATTACTCGAGTAATTGACCTCTTGCTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014606.1-1226s21c1
Sequence:CCGGGCCCGAGCTGATCGCTTTAAACTCGAGTTTAAAGCGATCAGCTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks