EMAIL THIS PAGE TO A FRIEND

HERPUD1

homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1

Synonyms: HERP Mif1 SUP
UniProtKB ID: Q15011, E9PGD1, O60644, Q6IAN8, Q96D92
Gene ID:
Human(9709) Summary: The accumulation of unfolded proteins in the endoplasmic reticulum (ER) triggers the ER stress response. This response includes the inhibition of translation to prevent further accumulation of unfolded proteins, the increased expression of proteins involved in polypeptide folding, known as the unfolded protein response (UPR), and the destruction of misfolded proteins by the ER-associated protein degradation (ERAD) system. This gene may play a role in both UPR and ERAD. Its expression is induced by UPR and it has an ER stress response element in its promoter region while the encoded protein has an N-terminal ubiquitin-like domain which may interact with the ERAD system. This protein has been shown to interact with presenilin proteins and to increase the level of amyloid-beta protein following its overexpression. Alternative splicing of this gene produces multiple transcript variants encoding different isoforms. The full-length nature of all transcript variants has not been determined. [provided by RefSeq, Jan 2013]
Mouse(64209) homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
Rat(85430) homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
Zebrafish(565499) homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
domestic cat(101082710) homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
cow(613577) homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
dog(478116) homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
chicken(415644) homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
domestic guinea pig(100725853) homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
naked mole-rat(101703450) homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
sheep(101121537) homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H6915 Anti-Herp (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, rat, human
immunofluorescence, immunoprecipitation, western blot pricing
H7040 Anti-Herp (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation, western blot pricing
H5665 Anti-HERPUD1 (341-355) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1406871 Anti-HERPUD1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA040754 Anti-HERPUD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA041219 Anti-HERPUD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1411694 Anti-HERPUD1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
WH0009709M4 Monoclonal Anti-HERPUD1 antibody produced in mouse clone 2G7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1404751 Monoclonal Anti-HERPUD1 antibody produced in mouse clone 3E10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022331 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022331 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022331 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014685 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014685 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014685 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010989 Rosetta Predictions human pricing
NM_001010990 Rosetta Predictions human pricing
NM_014685 Rosetta Predictions human pricing
NM_053523 Rosetta Predictions rat pricing
NM_022331 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063926 predicted 938
2 SASI_Hs01_00063928 predicted 1199
3 SASI_Hs01_00063929 predicted 1800
4 SASI_Hs01_00063930 predicted 1855
5 SASI_Hs01_00063931 predicted 1580
6 SASI_Hs02_00305959 predicted 1826
7 SASI_Hs01_00063932 predicted 1845
8 SASI_Hs01_00063934 predicted 1183
9 SASI_Hs01_00063935 predicted 1260
10 SASI_Hs02_00305960 predicted 1078
11 SASI_Hs01_00063927 predicted 1241
12 SASI_Hs01_00063933 predicted 1818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122498 predicted 869
2 SASI_Hs01_00122500 predicted 1131
3 SASI_Hs01_00122501 predicted 1725
4 SASI_Hs01_00122502 predicted 1783
5 SASI_Hs01_00122503 predicted 1508
6 SASI_Hs02_00305961 predicted 1760
7 SASI_Hs01_00122504 predicted 1772
8 SASI_Hs01_00122506 predicted 1118
9 SASI_Hs01_00122507 predicted 1190
10 SASI_Hs02_00305962 predicted 1010
11 SASI_Hs01_00122499 predicted 1163
12 SASI_Hs01_00122505 predicted 1747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185592 predicted 940
2 SASI_Hs01_00185594 predicted 1206
3 SASI_Hs01_00185595 predicted 1798
4 SASI_Hs01_00185596 predicted 1866
5 SASI_Hs01_00185597 predicted 1582
6 SASI_Hs02_00346048 predicted 1835
7 SASI_Hs01_00185598 predicted 1844
8 SASI_Hs01_00185600 predicted 1195
9 SASI_Hs01_00185601 predicted 1266
10 SASI_Hs02_00346049 predicted 1079
11 SASI_Hs01_00185593 predicted 1242
12 SASI_Hs01_00185599 predicted 1821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057861 predicted 1439
2 SASI_Rn01_00057862 predicted 1396
3 SASI_Rn01_00057863 predicted 1450
4 SASI_Rn01_00057864 predicted 626
5 SASI_Rn02_00266133 predicted 1469
6 SASI_Rn01_00057867 predicted 1103
7 SASI_Rn02_00266134 predicted 1142
8 SASI_Rn01_00057868 predicted 807
9 SASI_Rn02_00266135 predicted 693
10 SASI_Rn01_00057869 predicted 950
11 SASI_Rn01_00057865 predicted 865
12 SASI_Rn01_00057866 predicted 793
13 SASI_Rn01_00057870 predicted 1466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199341 predicted 1452
2 SASI_Mm01_00199342 predicted 453
3 SASI_Mm01_00199343 predicted 1467
4 SASI_Mm01_00199344 predicted 1421
5 SASI_Mm01_00199345 predicted 951
6 SASI_Mm01_00199346 predicted 1415
7 SASI_Mm01_00199347 predicted 470
8 SASI_Mm01_00199348 predicted 1481
9 SASI_Mm01_00199349 predicted 695
10 SASI_Mm01_00199350 predicted 1457
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022331
VALIDATED
HERPUD1 MISSION shRNA Bacterial Glycerol Stock
homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022331.1-1205s1c1
Sequence:CCGGGCTAGTCTTCAAGACTTTCTTCTCGAGAAGAAAGTCTTGAAGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022331.1-1461s1c1
Sequence:CCGGCGTTATTCTGAAGAGCTTTAACTCGAGTTAAAGCTCTTCAGAATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022331.1-1035s1c1
Sequence:CCGGGTTCAGAACTTCCCGGATGATCTCGAGATCATCCGGGAAGTTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022331.1-1183s1c1
Sequence:CCGGCCTCGTTTATGAGCACAGCATCTCGAGATGCTGTGCTCATAAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022331.1-729s1c1
Sequence:CCGGGCTCCTATACACAACCAGTTTCTCGAGAAACTGGTTGTGTATAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022331.1-1494s1c1
Sequence:CCGGGTAGTTTCATAGGCACTGTAACTCGAGTTACAGTGCCTATGAAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022331.1-350s1c1
Sequence:CCGGCAATGTGAAGAATCCCTCCAACTCGAGTTGGAGGGATTCTTCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022331.1-729s21c1
Sequence:CCGGGCTCCTATACACAACCAGTTTCTCGAGAAACTGGTTGTGTATAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022331.1-408s21c1
Sequence:CCGGGAGCAGCCGGACAACTCTAATCTCGAGATTAGAGTTGTCCGGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022331.1-1035s21c1
Sequence:CCGGGTTCAGAACTTCCCGGATGATCTCGAGATCATCCGGGAAGTTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022331.1-880s21c1
Sequence:CCGGACTGGTTGGATTGGACCTATTCTCGAGAATAGGTCCAATCCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279511    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022331.1-1461s21c1
Sequence:CCGGCGTTATTCTGAAGAGCTTTAACTCGAGTTAAAGCTCTTCAGAATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022331
VALIDATED
HERPUD1 MISSION shRNA shRNA Plasmid DNA
homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022331.1-1205s1c1
Sequence:CCGGGCTAGTCTTCAAGACTTTCTTCTCGAGAAGAAAGTCTTGAAGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022331.1-1461s1c1
Sequence:CCGGCGTTATTCTGAAGAGCTTTAACTCGAGTTAAAGCTCTTCAGAATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022331.1-1035s1c1
Sequence:CCGGGTTCAGAACTTCCCGGATGATCTCGAGATCATCCGGGAAGTTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022331.1-1183s1c1
Sequence:CCGGCCTCGTTTATGAGCACAGCATCTCGAGATGCTGTGCTCATAAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022331.1-729s1c1
Sequence:CCGGGCTCCTATACACAACCAGTTTCTCGAGAAACTGGTTGTGTATAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022331.1-1494s1c1
Sequence:CCGGGTAGTTTCATAGGCACTGTAACTCGAGTTACAGTGCCTATGAAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022331.1-350s1c1
Sequence:CCGGCAATGTGAAGAATCCCTCCAACTCGAGTTGGAGGGATTCTTCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022331.1-729s21c1
Sequence:CCGGGCTCCTATACACAACCAGTTTCTCGAGAAACTGGTTGTGTATAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022331.1-408s21c1
Sequence:CCGGGAGCAGCCGGACAACTCTAATCTCGAGATTAGAGTTGTCCGGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022331.1-1035s21c1
Sequence:CCGGGTTCAGAACTTCCCGGATGATCTCGAGATCATCCGGGAAGTTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022331.1-880s21c1
Sequence:CCGGACTGGTTGGATTGGACCTATTCTCGAGAATAGGTCCAATCCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279511    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022331.1-1461s21c1
Sequence:CCGGCGTTATTCTGAAGAGCTTTAACTCGAGTTAAAGCTCTTCAGAATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022331
VALIDATED
HERPUD1 MISSION shRNA Lentiviral Transduction Particles
homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022331.1-1205s1c1
Sequence:CCGGGCTAGTCTTCAAGACTTTCTTCTCGAGAAGAAAGTCTTGAAGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022331.1-1461s1c1
Sequence:CCGGCGTTATTCTGAAGAGCTTTAACTCGAGTTAAAGCTCTTCAGAATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022331.1-1035s1c1
Sequence:CCGGGTTCAGAACTTCCCGGATGATCTCGAGATCATCCGGGAAGTTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022331.1-1183s1c1
Sequence:CCGGCCTCGTTTATGAGCACAGCATCTCGAGATGCTGTGCTCATAAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022331.1-729s1c1
Sequence:CCGGGCTCCTATACACAACCAGTTTCTCGAGAAACTGGTTGTGTATAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022331.1-1494s1c1
Sequence:CCGGGTAGTTTCATAGGCACTGTAACTCGAGTTACAGTGCCTATGAAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022331.1-350s1c1
Sequence:CCGGCAATGTGAAGAATCCCTCCAACTCGAGTTGGAGGGATTCTTCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022331.1-729s21c1
Sequence:CCGGGCTCCTATACACAACCAGTTTCTCGAGAAACTGGTTGTGTATAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022331.1-408s21c1
Sequence:CCGGGAGCAGCCGGACAACTCTAATCTCGAGATTAGAGTTGTCCGGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022331.1-1035s21c1
Sequence:CCGGGTTCAGAACTTCCCGGATGATCTCGAGATCATCCGGGAAGTTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022331.1-880s21c1
Sequence:CCGGACTGGTTGGATTGGACCTATTCTCGAGAATAGGTCCAATCCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279511    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022331.1-1461s21c1
Sequence:CCGGCGTTATTCTGAAGAGCTTTAACTCGAGTTAAAGCTCTTCAGAATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014685
HERPUD1 MISSION shRNA Bacterial Glycerol Stock
homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014685.x-983s1c1
Sequence:CCGGCACCGTTGTTATGTACCTGCACTCGAGTGCAGGTACATAACAACGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014685.x-1381s1c1
Sequence:CCGGGTGTGGATGATGATATGCTTTCTCGAGAAAGCATATCATCATCCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014685.x-1062s1c1
Sequence:CCGGCCTCCTCCTGACGTTGTAAATCTCGAGATTTACAACGTCAGGAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014685.x-349s1c1
Sequence:CCGGTGTGCAATGTGAAGAGTCCTTCTCGAGAAGGACTCTTCACATTGCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014685.x-270s1c1
Sequence:CCGGTCTGGGAAGCTGTTGTTGGATCTCGAGATCCAACAACAGCTTCCCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014685.2-584s21c1
Sequence:CCGGTCTGGGAAGCTGTTGTTGGATCTCGAGATCCAACAACAGCTTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014685.2-1376s21c1
Sequence:CCGGCCTCCTCCTGACGTTGTAAATCTCGAGATTTACAACGTCAGGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014685.2-1695s21c1
Sequence:CCGGGTGTGGATGATGATATGCTTTCTCGAGAAAGCATATCATCATCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014685.2-663s21c1
Sequence:CCGGTGTGCAATGTGAAGAGTCCTTCTCGAGAAGGACTCTTCACATTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014685
HERPUD1 MISSION shRNA shRNA Plasmid DNA
homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014685.x-983s1c1
Sequence:CCGGCACCGTTGTTATGTACCTGCACTCGAGTGCAGGTACATAACAACGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014685.x-1381s1c1
Sequence:CCGGGTGTGGATGATGATATGCTTTCTCGAGAAAGCATATCATCATCCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014685.x-1062s1c1
Sequence:CCGGCCTCCTCCTGACGTTGTAAATCTCGAGATTTACAACGTCAGGAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014685.x-349s1c1
Sequence:CCGGTGTGCAATGTGAAGAGTCCTTCTCGAGAAGGACTCTTCACATTGCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014685.x-270s1c1
Sequence:CCGGTCTGGGAAGCTGTTGTTGGATCTCGAGATCCAACAACAGCTTCCCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014685.2-584s21c1
Sequence:CCGGTCTGGGAAGCTGTTGTTGGATCTCGAGATCCAACAACAGCTTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014685.2-1376s21c1
Sequence:CCGGCCTCCTCCTGACGTTGTAAATCTCGAGATTTACAACGTCAGGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014685.2-1695s21c1
Sequence:CCGGGTGTGGATGATGATATGCTTTCTCGAGAAAGCATATCATCATCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014685.2-663s21c1
Sequence:CCGGTGTGCAATGTGAAGAGTCCTTCTCGAGAAGGACTCTTCACATTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014685
HERPUD1 MISSION shRNA Lentiviral Transduction Particles
homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014685.x-983s1c1
Sequence:CCGGCACCGTTGTTATGTACCTGCACTCGAGTGCAGGTACATAACAACGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014685.x-1381s1c1
Sequence:CCGGGTGTGGATGATGATATGCTTTCTCGAGAAAGCATATCATCATCCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014685.x-1062s1c1
Sequence:CCGGCCTCCTCCTGACGTTGTAAATCTCGAGATTTACAACGTCAGGAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014685.x-349s1c1
Sequence:CCGGTGTGCAATGTGAAGAGTCCTTCTCGAGAAGGACTCTTCACATTGCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014685.x-270s1c1
Sequence:CCGGTCTGGGAAGCTGTTGTTGGATCTCGAGATCCAACAACAGCTTCCCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014685.2-584s21c1
Sequence:CCGGTCTGGGAAGCTGTTGTTGGATCTCGAGATCCAACAACAGCTTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014685.2-1376s21c1
Sequence:CCGGCCTCCTCCTGACGTTGTAAATCTCGAGATTTACAACGTCAGGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014685.2-1695s21c1
Sequence:CCGGGTGTGGATGATGATATGCTTTCTCGAGAAAGCATATCATCATCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014685.2-663s21c1
Sequence:CCGGTGTGCAATGTGAAGAGTCCTTCTCGAGAAGGACTCTTCACATTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks