EMAIL THIS PAGE TO A FRIEND

HES5

hairy and enhancer of split 5 (Drosophila)

Synonyms: bHLHb38
UniProtKB ID: Q5TA89, B9DI85
Gene ID:
Human(388585) Summary: This gene encodes a member of a family of basic helix-loop-helix transcriptional repressors. The protein product of this gene, which is activated downstream of the Notch pathway, regulates cell differentiation in multiple tissues. Disruptions in the normal expression of this gene have been associated with developmental diseases and cancer. [provided by RefSeq, Dec 2008]
Mouse(15208) hairy and enhancer of split 5 (Drosophila)
Rat(79225) hairy and enhancer of split 5 (Drosophila)
chicken(419392) hairy and enhancer of split 5 (Drosophila)
dog(489614) hairy and enhancer of split 5 (Drosophila)
cow(787633) hairy and enhancer of split 5 (Drosophila)
domestic cat(101089627) hairy and enhancer of split 5 (Drosophila)
sheep(101103410) hairy and enhancer of split 5 (Drosophila)
domestic guinea pig(100725154) hairy and enhancer of split 5 (Drosophila)
naked mole-rat(101724400) hairy and enhancer of split 5 (Drosophila)
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_371215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371215 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010419 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010419 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010419 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010926 Rosetta Predictions human pricing
NM_024383 Rosetta Predictions rat pricing
NM_010419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305918 predicted 785
2 SASI_Hs02_00305919 predicted 782
3 SASI_Hs01_00058662 predicted 974
4 SASI_Hs01_00058663 predicted 984
5 SASI_Hs01_00058664 predicted 948
6 SASI_Hs01_00058665 predicted 1016
7 SASI_Hs01_00058666 predicted 982
8 SASI_Hs01_00058667 predicted 1011
9 SASI_Hs01_00058668 predicted 979
10 SASI_Hs01_00058669 predicted 779
11 SASI_Hs01_00058661 predicted 922
12 SASI_Hs01_00058670 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097739 predicted 340
2 SASI_Rn01_00097740 predicted 241
3 SASI_Rn01_00097741 predicted 238
4 SASI_Rn01_00097742 predicted 245
5 SASI_Rn01_00097743 predicted 315
6 SASI_Rn01_00097744 predicted 334
7 SASI_Rn01_00097745 predicted 298
8 SASI_Rn01_00097746 predicted 250
9 SASI_Rn01_00097747 predicted 342
10 SASI_Rn01_00097748 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020733 predicted 398
2 SASI_Mm01_00020734 predicted 730
3 SASI_Mm02_00318564 predicted 720
4 SASI_Mm01_00020736 predicted 261
5 SASI_Mm01_00020737 predicted 869
6 SASI_Mm01_00020738 predicted 364
7 SASI_Mm01_00020739 predicted 827
8 SASI_Mm01_00020741 predicted 907
9 SASI_Mm01_00020742 predicted 839
10 SASI_Mm02_00318565 predicted 624
11 SASI_Mm01_00020735 predicted 725
12 SASI_Mm01_00020740 predicted 1011
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371215
HES5 MISSION shRNA Bacterial Glycerol Stock
hairy and enhancer of split 5 (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371215.1-274s1c1
Sequence:CCGGGCTGTCAGCTACCTGAAGCACCTCGAGGTGCTTCAGGTAGCTGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371215.1-336s1c1
Sequence:CCGGCCAGGACTACAGCGAAGGCTACTCGAGTAGCCTTCGCTGTAGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371215.1-402s1c1
Sequence:CCGGCGCCAGCGACACGCAGATGAACTCGAGTTCATCTGCGTGTCGCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371215.1-348s1c1
Sequence:CCGGCGAAGGCTACTCGTGGTGCCTCTCGAGAGGCACCACGAGTAGCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371215.1-189s1c1
Sequence:CCGGCGAGCAGCTGAAGCTGCTGCTCTCGAGAGCAGCAGCTTCAGCTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371215
HES5 MISSION shRNA shRNA Plasmid DNA
hairy and enhancer of split 5 (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371215.1-274s1c1
Sequence:CCGGGCTGTCAGCTACCTGAAGCACCTCGAGGTGCTTCAGGTAGCTGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371215.1-336s1c1
Sequence:CCGGCCAGGACTACAGCGAAGGCTACTCGAGTAGCCTTCGCTGTAGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371215.1-402s1c1
Sequence:CCGGCGCCAGCGACACGCAGATGAACTCGAGTTCATCTGCGTGTCGCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371215.1-348s1c1
Sequence:CCGGCGAAGGCTACTCGTGGTGCCTCTCGAGAGGCACCACGAGTAGCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371215.1-189s1c1
Sequence:CCGGCGAGCAGCTGAAGCTGCTGCTCTCGAGAGCAGCAGCTTCAGCTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371215
HES5 MISSION shRNA Lentiviral Transduction Particles
hairy and enhancer of split 5 (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371215.1-274s1c1
Sequence:CCGGGCTGTCAGCTACCTGAAGCACCTCGAGGTGCTTCAGGTAGCTGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371215.1-336s1c1
Sequence:CCGGCCAGGACTACAGCGAAGGCTACTCGAGTAGCCTTCGCTGTAGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371215.1-402s1c1
Sequence:CCGGCGCCAGCGACACGCAGATGAACTCGAGTTCATCTGCGTGTCGCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371215.1-348s1c1
Sequence:CCGGCGAAGGCTACTCGTGGTGCCTCTCGAGAGGCACCACGAGTAGCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371215.1-189s1c1
Sequence:CCGGCGAGCAGCTGAAGCTGCTGCTCTCGAGAGCAGCAGCTTCAGCTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010419
HES5 MISSION shRNA Bacterial Glycerol Stock
hairy and enhancer of split 5 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010419.2-504s1c1
Sequence:CCGGTCCTCCGCTAAGGCTGCTGCTCTCGAGAGCAGCAGCCTTAGCGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010419.2-407s1c1
Sequence:CCGGGCAGATGAAGCTGCTTTACCACTCGAGTGGTAAAGCAGCTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010419.2-268s1c1
Sequence:CCGGCCGTCAGCTACCTGAAACACACTCGAGTGTGTTTCAGGTAGCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010419.2-101s1c1
Sequence:CCGGGATGCTCAGTCCCAAGGAGAACTCGAGTTCTCCTTGGGACTGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010419.2-173s1c1
Sequence:CCGGCAGCAGCATAGAGCAGCTGAACTCGAGTTCAGCTGCTCTATGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010419
HES5 MISSION shRNA shRNA Plasmid DNA
hairy and enhancer of split 5 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010419.2-504s1c1
Sequence:CCGGTCCTCCGCTAAGGCTGCTGCTCTCGAGAGCAGCAGCCTTAGCGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010419.2-407s1c1
Sequence:CCGGGCAGATGAAGCTGCTTTACCACTCGAGTGGTAAAGCAGCTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010419.2-268s1c1
Sequence:CCGGCCGTCAGCTACCTGAAACACACTCGAGTGTGTTTCAGGTAGCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010419.2-101s1c1
Sequence:CCGGGATGCTCAGTCCCAAGGAGAACTCGAGTTCTCCTTGGGACTGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010419.2-173s1c1
Sequence:CCGGCAGCAGCATAGAGCAGCTGAACTCGAGTTCAGCTGCTCTATGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010419
HES5 MISSION shRNA Lentiviral Transduction Particles
hairy and enhancer of split 5 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010419.2-504s1c1
Sequence:CCGGTCCTCCGCTAAGGCTGCTGCTCTCGAGAGCAGCAGCCTTAGCGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010419.2-407s1c1
Sequence:CCGGGCAGATGAAGCTGCTTTACCACTCGAGTGGTAAAGCAGCTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010419.2-268s1c1
Sequence:CCGGCCGTCAGCTACCTGAAACACACTCGAGTGTGTTTCAGGTAGCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010419.2-101s1c1
Sequence:CCGGGATGCTCAGTCCCAAGGAGAACTCGAGTTCTCCTTGGGACTGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010419.2-173s1c1
Sequence:CCGGCAGCAGCATAGAGCAGCTGAACTCGAGTTCAGCTGCTCTATGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks