EMAIL THIS PAGE TO A FRIEND

HEXB

hexosaminidase B (beta polypeptide)

Synonyms: ENC-1AS
UniProtKB ID: P07686
Gene ID:
Human(3074) Summary: Hexosaminidase B is the beta subunit of the lysosomal enzyme beta-hexosaminidase that, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Beta-hexosaminidase is composed of two subunits, alpha and beta, which are encoded by separate genes. Both beta-hexosaminidase alpha and beta subunits are members of family 20 of glycosyl hydrolases. Mutations in the alpha or beta subunit genes lead to an accumulation of GM2 ganglioside in neurons and neurodegenerative disorders termed the GM2 gangliosidoses. Beta subunit gene mutations lead to Sandhoff disease (GM2-gangliosidosis type II). [provided by RefSeq, Jul 2008]
Mouse(15212) hexosaminidase B
Rat(294673) hexosaminidase B
chicken(427204) hexosaminidase B (beta polypeptide)
dog(478100) hexosaminidase B (beta polypeptide)
domestic cat(493928) hexosaminidase B (beta polypeptide)
cow(618571) hexosaminidase B (beta polypeptide)
domestic guinea pig(100731613) hexosaminidase B (beta polypeptide)
naked mole-rat(101713145) hexosaminidase B (beta polypeptide)
sheep(101111906) hexosaminidase B (beta polypeptide)
Domestic Rabbit(100009508) hexosaminidase B (beta polypeptide)
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010422 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010422 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010422 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000521 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000521 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000521 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000521 Rosetta Predictions human pricing
NM_001011946 Rosetta Predictions rat pricing
XM_574839 Rosetta Predictions rat pricing
NM_010422 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045752 predicted 1591
2 SASI_Hs01_00045753 predicted 1305
3 SASI_Hs01_00045754 predicted 664
4 SASI_Hs01_00045755 predicted 946
5 SASI_Hs01_00045756 predicted 1675
6 SASI_Hs01_00045757 predicted 844
7 SASI_Hs01_00045758 predicted 405
8 SASI_Hs01_00045759 predicted 916
9 SASI_Hs01_00045760 predicted 899
10 SASI_Hs01_00045761 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011946 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121138 predicted 1488
2 SASI_Rn01_00121139 predicted 733
3 SASI_Rn01_00121140 predicted 577
4 SASI_Rn01_00121141 predicted 1621
5 SASI_Rn01_00121142 predicted 518
6 SASI_Rn02_00199961 predicted 510
7 SASI_Rn01_00121145 predicted 977
8 SASI_Rn01_00121146 predicted 809
9 SASI_Rn01_00121147 predicted 1071
10 SASI_Rn02_00199962 predicted 1435
11 SASI_Rn01_00121143 predicted 1185
12 SASI_Rn01_00121144 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574839 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00161437 predicted 950
2 SASI_Rn01_00161438 predicted 1170
3 SASI_Rn01_00161439 predicted 229
4 SASI_Rn01_00161440 predicted 968
5 SASI_Rn01_00161441 predicted 1018
6 SASI_Rn01_00161442 predicted 804
7 SASI_Rn01_00161443 predicted 951
8 SASI_Rn01_00161444 predicted 975
9 SASI_Rn01_00161445 predicted 1065
10 SASI_Rn01_00161446 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093403 predicted 994
2 SASI_Mm02_00318567 predicted 1151
3 SASI_Mm01_00093404 predicted 675
4 SASI_Mm02_00318568 predicted 373
5 SASI_Mm01_00093405 predicted 327
6 SASI_Mm01_00093406 predicted 1144
7 SASI_Mm02_00318569 predicted 667
8 SASI_Mm01_00093408 predicted 793
9 SASI_Mm01_00093409 predicted 1007
10 SASI_Mm01_00093410 predicted 472
11 SASI_Mm01_00093407 predicted 802
12 SASI_Mm01_00093411 predicted 1434
13 SASI_Mm01_00093412 predicted 1438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010422
HEXB MISSION shRNA Bacterial Glycerol Stock
hexosaminidase B (beta polypeptide)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010422.1-241s1c1
Sequence:CCGGCGGCGATATTACAACTATGTTCTCGAGAACATAGTTGTAATATCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010422.1-486s1c1
Sequence:CCGGCCAAGACTCTTTCGGGACTTTCTCGAGAAAGTCCCGAAAGAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010422.1-678s1c1
Sequence:CCGGCCCTTATCAGAGTACCACTTTCTCGAGAAAGTGGTACTCTGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010422.1-1030s1c1
Sequence:CCGGGCATCAAATCCAAACATCCAACTCGAGTTGGATGTTTGGATTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010422.1-1580s1c1
Sequence:CCGGCTCTCTATACTGGATACTGTACTCGAGTACAGTATCCAGTATAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010422.2-1117s21c1
Sequence:CCGGGCATCAAATCCAAACATCCAACTCGAGTTGGATGTTTGGATTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010422.2-765s21c1
Sequence:CCGGCCCTTATCAGAGTACCACTTTCTCGAGAAAGTGGTACTCTGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010422.2-1667s21c1
Sequence:CCGGCTCTCTATACTGGATACTGTACTCGAGTACAGTATCCAGTATAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010422.2-328s21c1
Sequence:CCGGCGGCGATATTACAACTATGTTCTCGAGAACATAGTTGTAATATCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010422.2-573s21c1
Sequence:CCGGCCAAGACTCTTTCGGGACTTTCTCGAGAAAGTCCCGAAAGAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010422
HEXB MISSION shRNA shRNA Plasmid DNA
hexosaminidase B (beta polypeptide)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010422.1-241s1c1
Sequence:CCGGCGGCGATATTACAACTATGTTCTCGAGAACATAGTTGTAATATCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010422.1-486s1c1
Sequence:CCGGCCAAGACTCTTTCGGGACTTTCTCGAGAAAGTCCCGAAAGAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010422.1-678s1c1
Sequence:CCGGCCCTTATCAGAGTACCACTTTCTCGAGAAAGTGGTACTCTGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010422.1-1030s1c1
Sequence:CCGGGCATCAAATCCAAACATCCAACTCGAGTTGGATGTTTGGATTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010422.1-1580s1c1
Sequence:CCGGCTCTCTATACTGGATACTGTACTCGAGTACAGTATCCAGTATAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010422.2-1117s21c1
Sequence:CCGGGCATCAAATCCAAACATCCAACTCGAGTTGGATGTTTGGATTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010422.2-765s21c1
Sequence:CCGGCCCTTATCAGAGTACCACTTTCTCGAGAAAGTGGTACTCTGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010422.2-1667s21c1
Sequence:CCGGCTCTCTATACTGGATACTGTACTCGAGTACAGTATCCAGTATAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010422.2-328s21c1
Sequence:CCGGCGGCGATATTACAACTATGTTCTCGAGAACATAGTTGTAATATCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010422.2-573s21c1
Sequence:CCGGCCAAGACTCTTTCGGGACTTTCTCGAGAAAGTCCCGAAAGAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010422
HEXB MISSION shRNA Lentiviral Transduction Particles
hexosaminidase B (beta polypeptide)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010422.1-241s1c1
Sequence:CCGGCGGCGATATTACAACTATGTTCTCGAGAACATAGTTGTAATATCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010422.1-486s1c1
Sequence:CCGGCCAAGACTCTTTCGGGACTTTCTCGAGAAAGTCCCGAAAGAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010422.1-678s1c1
Sequence:CCGGCCCTTATCAGAGTACCACTTTCTCGAGAAAGTGGTACTCTGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010422.1-1030s1c1
Sequence:CCGGGCATCAAATCCAAACATCCAACTCGAGTTGGATGTTTGGATTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010422.1-1580s1c1
Sequence:CCGGCTCTCTATACTGGATACTGTACTCGAGTACAGTATCCAGTATAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010422.2-1117s21c1
Sequence:CCGGGCATCAAATCCAAACATCCAACTCGAGTTGGATGTTTGGATTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010422.2-765s21c1
Sequence:CCGGCCCTTATCAGAGTACCACTTTCTCGAGAAAGTGGTACTCTGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010422.2-1667s21c1
Sequence:CCGGCTCTCTATACTGGATACTGTACTCGAGTACAGTATCCAGTATAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010422.2-328s21c1
Sequence:CCGGCGGCGATATTACAACTATGTTCTCGAGAACATAGTTGTAATATCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010422.2-573s21c1
Sequence:CCGGCCAAGACTCTTTCGGGACTTTCTCGAGAAAGTCCCGAAAGAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000521
VALIDATED
HEXB MISSION shRNA Bacterial Glycerol Stock
hexosaminidase B (beta polypeptide)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000521.2-602s1c1
Sequence:CCGGGCCAGTTAGTTTATCAAGATTCTCGAGAATCTTGATAAACTAACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000521.2-1325s1c1
Sequence:CCGGCGGGCACAATAGTTGAAGTATCTCGAGATACTTCAACTATTGTGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000521.2-370s1c1
Sequence:CCGGCGACGATATCATGGCTATATTCTCGAGAATATAGCCATGATATCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000521.2-1705s1c1
Sequence:CCGGCAACCTCTTTATGCTGGATATCTCGAGATATCCAGCATAAAGAGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000521.2-704s1c1
Sequence:CCGGCCAGACATTATCTGCCAGTTACTCGAGTAACTGGCAGATAATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000521.3-412s21c1
Sequence:CCGGCGACGATATCATGGCTATATTCTCGAGAATATAGCCATGATATCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000521.3-1293s21c1
Sequence:CCGGGGATATTATTGCAACCATAAACTCGAGTTTATGGTTGCAATAATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000521.3-748s21c1
Sequence:GTACCGGAGACATTATCTGCCAGTTAAGCTCGAGCTTAACTGGCAGATAATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000521.3-928s21c1
Sequence:GTACCGGGTCCGTATGGTGATTGAATATCTCGAGATATTCAATCACCATACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000521.3-544s21c1
Sequence:CCGGATATCTTCAGATGAGTCTTATCTCGAGATAAGACTCATCTGAAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000521
VALIDATED
HEXB MISSION shRNA shRNA Plasmid DNA
hexosaminidase B (beta polypeptide)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000521.2-602s1c1
Sequence:CCGGGCCAGTTAGTTTATCAAGATTCTCGAGAATCTTGATAAACTAACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000521.2-1325s1c1
Sequence:CCGGCGGGCACAATAGTTGAAGTATCTCGAGATACTTCAACTATTGTGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000521.2-370s1c1
Sequence:CCGGCGACGATATCATGGCTATATTCTCGAGAATATAGCCATGATATCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000521.2-1705s1c1
Sequence:CCGGCAACCTCTTTATGCTGGATATCTCGAGATATCCAGCATAAAGAGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000521.2-704s1c1
Sequence:CCGGCCAGACATTATCTGCCAGTTACTCGAGTAACTGGCAGATAATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000521.3-412s21c1
Sequence:CCGGCGACGATATCATGGCTATATTCTCGAGAATATAGCCATGATATCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000521.3-1293s21c1
Sequence:CCGGGGATATTATTGCAACCATAAACTCGAGTTTATGGTTGCAATAATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000521.3-748s21c1
Sequence:GTACCGGAGACATTATCTGCCAGTTAAGCTCGAGCTTAACTGGCAGATAATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000521.3-928s21c1
Sequence:GTACCGGGTCCGTATGGTGATTGAATATCTCGAGATATTCAATCACCATACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000521.3-544s21c1
Sequence:CCGGATATCTTCAGATGAGTCTTATCTCGAGATAAGACTCATCTGAAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000521
VALIDATED
HEXB MISSION shRNA Lentiviral Transduction Particles
hexosaminidase B (beta polypeptide)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000521.2-602s1c1
Sequence:CCGGGCCAGTTAGTTTATCAAGATTCTCGAGAATCTTGATAAACTAACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000521.2-1325s1c1
Sequence:CCGGCGGGCACAATAGTTGAAGTATCTCGAGATACTTCAACTATTGTGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000521.2-370s1c1
Sequence:CCGGCGACGATATCATGGCTATATTCTCGAGAATATAGCCATGATATCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000521.2-1705s1c1
Sequence:CCGGCAACCTCTTTATGCTGGATATCTCGAGATATCCAGCATAAAGAGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000521.2-704s1c1
Sequence:CCGGCCAGACATTATCTGCCAGTTACTCGAGTAACTGGCAGATAATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000521.3-412s21c1
Sequence:CCGGCGACGATATCATGGCTATATTCTCGAGAATATAGCCATGATATCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000521.3-1293s21c1
Sequence:CCGGGGATATTATTGCAACCATAAACTCGAGTTTATGGTTGCAATAATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000521.3-748s21c1
Sequence:GTACCGGAGACATTATCTGCCAGTTAAGCTCGAGCTTAACTGGCAGATAATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000521.3-928s21c1
Sequence:GTACCGGGTCCGTATGGTGATTGAATATCTCGAGATATTCAATCACCATACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000521.3-544s21c1
Sequence:CCGGATATCTTCAGATGAGTCTTATCTCGAGATAAGACTCATCTGAAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks