EMAIL THIS PAGE TO A FRIEND

HEY2

hairy/enhancer-of-split related with YRPW motif 2

Synonyms: CHF1 GRIDLOCK GRL HERP1 HESR2 HRT2 bHLHb32
UniProtKB ID: Q9UBP5
Gene ID:
Human(23493) Summary: This gene encodes a member of the hairy and enhancer of split-related (HESR) family of basic helix-loop-helix (bHLH)-type transcription factors. The encoded protein forms homo- or hetero-dimers that localize to the nucleus and interact with a histone deacetylase complex to repress transcription. Expression of this gene is induced by the Notch signal transduction pathway. Two similar and redundant genes in mouse are required for embryonic cardiovascular development, and are also implicated in neurogenesis and somitogenesis. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(15214) hairy/enhancer-of-split related with YRPW motif 2
Rat(155430) hairy/enhancer-of-split related with YRPW motif 2
sheep(100271925) hairy/enhancer-of-split related with YRPW motif 2
domestic guinea pig(100727826) hairy/enhancer-of-split related with YRPW motif 2
naked mole-rat(101716129) hairy/enhancer-of-split related with YRPW motif 2
Zebrafish(58146) hairy/enhancer-of-split related with YRPW motif 2
dog(484115) hairy/enhancer-of-split related with YRPW motif 2
cow(538619) hairy/enhancer-of-split related with YRPW motif 2
domestic cat(101083681) hairy/enhancer-of-split related with YRPW motif 2
chicken(421718) hairy/enhancer-of-split related with YRPW motif 2
188 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012259 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012259 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012259 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013904 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013904 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013904 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012259 Rosetta Predictions human pricing
XM_001058425 Rosetta Predictions rat pricing
XM_344806 Rosetta Predictions rat pricing
NM_013904 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343977 predicted 530
2 SASI_Hs01_00166344 predicted 1131
3 SASI_Hs01_00166345 predicted 886
4 SASI_Hs01_00166346 predicted 1090
5 SASI_Hs01_00166347 predicted 869
6 SASI_Hs02_00343978 predicted 280
7 SASI_Hs01_00166348 predicted 474
8 SASI_Hs01_00166349 predicted 370
9 SASI_Hs02_00343979 predicted 313
10 SASI_Hs02_00343980 predicted 285
11 SASI_Hs01_00166350 predicted 427
12 SASI_Hs01_00166351 predicted 738
13 SASI_Hs01_00166352 predicted 235
14 SASI_Hs01_00166353 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058425 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289693 predicted 241
2 SASI_Rn02_00289694 predicted 756
3 SASI_Rn02_00289695 predicted 343
4 SASI_Rn02_00289696 predicted 418
5 SASI_Rn02_00289697 predicted 1085
6 SASI_Rn02_00289698 predicted 501
7 SASI_Rn02_00289699 predicted 832
8 SASI_Rn02_00289700 predicted 394
9 SASI_Rn02_00289701 predicted 966
10 SASI_Rn02_00289702 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344806 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397565 predicted 343
2 SASI_Rn02_00397566 predicted 181
3 SASI_Rn02_00397567 predicted 414
4 SASI_Rn02_00397568 predicted 247
5 SASI_Rn02_00397569 predicted 764
6 SASI_Rn02_00397570 predicted 1091
7 SASI_Rn02_00397571 predicted 391
8 SASI_Rn02_00397572 predicted 965
9 SASI_Rn02_00397573 predicted 1062
10 SASI_Rn02_00397574 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013904 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102464 predicted 1080
2 SASI_Mm01_00102465 predicted 316
3 SASI_Mm01_00102466 predicted 213
4 SASI_Mm01_00102467 predicted 1158
5 SASI_Mm01_00102468 predicted 811
6 SASI_Mm01_00102469 predicted 458
7 SASI_Mm01_00102470 predicted 834
8 SASI_Mm01_00102472 predicted 412
9 SASI_Mm02_00322987 predicted 1209
10 SASI_Mm01_00102473 predicted 724
11 SASI_Mm01_00102471 predicted 1132
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012259
VALIDATED
HEY2 MISSION shRNA Bacterial Glycerol Stock
hairy/enhancer-of-split related with YRPW motif 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012259.2-1303s21c1
Sequence:CCGGAGATCCACAAAGGAACAATAACTCGAGTTATTGTTCCTTTGTGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012259.2-563s21c1
Sequence:CCGGAGGATTCCGAGAGTGCCTAACCTCGAGGTTAGGCACTCTCGGAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012259.2-1581s21c1
Sequence:CCGGAGAGTGAGAGAGTCGTGTTTCCTCGAGGAAACACGACTCTCTCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012259.2-879s21c1
Sequence:CCGGACGTTTGCCCATGCGGATTCACTCGAGTGAATCCGCATGGGCAAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012259.1-145s1c1
Sequence:CCGGGCTCTGTGATTAGATTGAATTCTCGAGAATTCAATCTAATCACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012259.1-227s1c1
Sequence:CCGGGCGTCGGGATCGGATAAATAACTCGAGTTATTTATCCGATCCCGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012259.1-1004s1c1
Sequence:CCGGCAGCAGTGGAACAAACAATAACTCGAGTTATTGTTTGTTCCACTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012259.1-168s1c1
Sequence:CCGGCCAACAACAACATCTCAGATTCTCGAGAATCTGAGATGTTGTTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012259.1-339s1c1
Sequence:CCGGGTGGATCATTTGAAGATGCTTCTCGAGAAGCATCTTCAAATGATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012259
VALIDATED
HEY2 MISSION shRNA shRNA Plasmid DNA
hairy/enhancer-of-split related with YRPW motif 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012259.2-1303s21c1
Sequence:CCGGAGATCCACAAAGGAACAATAACTCGAGTTATTGTTCCTTTGTGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012259.2-563s21c1
Sequence:CCGGAGGATTCCGAGAGTGCCTAACCTCGAGGTTAGGCACTCTCGGAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012259.2-1581s21c1
Sequence:CCGGAGAGTGAGAGAGTCGTGTTTCCTCGAGGAAACACGACTCTCTCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012259.2-879s21c1
Sequence:CCGGACGTTTGCCCATGCGGATTCACTCGAGTGAATCCGCATGGGCAAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012259.1-145s1c1
Sequence:CCGGGCTCTGTGATTAGATTGAATTCTCGAGAATTCAATCTAATCACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012259.1-227s1c1
Sequence:CCGGGCGTCGGGATCGGATAAATAACTCGAGTTATTTATCCGATCCCGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012259.1-1004s1c1
Sequence:CCGGCAGCAGTGGAACAAACAATAACTCGAGTTATTGTTTGTTCCACTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012259.1-168s1c1
Sequence:CCGGCCAACAACAACATCTCAGATTCTCGAGAATCTGAGATGTTGTTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012259.1-339s1c1
Sequence:CCGGGTGGATCATTTGAAGATGCTTCTCGAGAAGCATCTTCAAATGATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012259
VALIDATED
HEY2 MISSION shRNA Lentiviral Transduction Particles
hairy/enhancer-of-split related with YRPW motif 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012259.2-1303s21c1
Sequence:CCGGAGATCCACAAAGGAACAATAACTCGAGTTATTGTTCCTTTGTGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012259.2-563s21c1
Sequence:CCGGAGGATTCCGAGAGTGCCTAACCTCGAGGTTAGGCACTCTCGGAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012259.2-1581s21c1
Sequence:CCGGAGAGTGAGAGAGTCGTGTTTCCTCGAGGAAACACGACTCTCTCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012259.2-879s21c1
Sequence:CCGGACGTTTGCCCATGCGGATTCACTCGAGTGAATCCGCATGGGCAAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012259.1-145s1c1
Sequence:CCGGGCTCTGTGATTAGATTGAATTCTCGAGAATTCAATCTAATCACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012259.1-227s1c1
Sequence:CCGGGCGTCGGGATCGGATAAATAACTCGAGTTATTTATCCGATCCCGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012259.1-1004s1c1
Sequence:CCGGCAGCAGTGGAACAAACAATAACTCGAGTTATTGTTTGTTCCACTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012259.1-168s1c1
Sequence:CCGGCCAACAACAACATCTCAGATTCTCGAGAATCTGAGATGTTGTTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012259.1-339s1c1
Sequence:CCGGGTGGATCATTTGAAGATGCTTCTCGAGAAGCATCTTCAAATGATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013904
HEY2 MISSION shRNA Bacterial Glycerol Stock
hairy/enhancer-of-split related with YRPW motif 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013904.1-1180s21c1
Sequence:CCGGAGTAACTGATGTCGTCCATTTCTCGAGAAATGGACGACATCAGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013904.1-1299s21c1
Sequence:CCGGCAAATGGAAATGTAGTATTACCTCGAGGTAATACTACATTTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013904.1-264s1c1
Sequence:CCGGCTCTCAGATTATGGCAAGAAACTCGAGTTTCTTGCCATAATCTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013904.1-896s1c1
Sequence:CCGGCCACCTCTCTTCTGTCTCTTTCTCGAGAAAGAGACAGAAGAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013904.1-230s1c1
Sequence:CCGGGCTCAGTGATGAGGTCCAATTCTCGAGAATTGGACCTCATCACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013904.1-1657s1c1
Sequence:CCGGGCCAGAAAGATGAAGGGAAATCTCGAGATTTCCCTTCATCTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013904.1-263s1c1
Sequence:CCGGCCTCTCAGATTATGGCAAGAACTCGAGTTCTTGCCATAATCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013904
HEY2 MISSION shRNA shRNA Plasmid DNA
hairy/enhancer-of-split related with YRPW motif 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013904.1-1180s21c1
Sequence:CCGGAGTAACTGATGTCGTCCATTTCTCGAGAAATGGACGACATCAGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013904.1-1299s21c1
Sequence:CCGGCAAATGGAAATGTAGTATTACCTCGAGGTAATACTACATTTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013904.1-264s1c1
Sequence:CCGGCTCTCAGATTATGGCAAGAAACTCGAGTTTCTTGCCATAATCTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013904.1-896s1c1
Sequence:CCGGCCACCTCTCTTCTGTCTCTTTCTCGAGAAAGAGACAGAAGAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013904.1-230s1c1
Sequence:CCGGGCTCAGTGATGAGGTCCAATTCTCGAGAATTGGACCTCATCACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013904.1-1657s1c1
Sequence:CCGGGCCAGAAAGATGAAGGGAAATCTCGAGATTTCCCTTCATCTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013904.1-263s1c1
Sequence:CCGGCCTCTCAGATTATGGCAAGAACTCGAGTTCTTGCCATAATCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013904
HEY2 MISSION shRNA Lentiviral Transduction Particles
hairy/enhancer-of-split related with YRPW motif 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013904.1-1180s21c1
Sequence:CCGGAGTAACTGATGTCGTCCATTTCTCGAGAAATGGACGACATCAGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013904.1-1299s21c1
Sequence:CCGGCAAATGGAAATGTAGTATTACCTCGAGGTAATACTACATTTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013904.1-264s1c1
Sequence:CCGGCTCTCAGATTATGGCAAGAAACTCGAGTTTCTTGCCATAATCTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013904.1-896s1c1
Sequence:CCGGCCACCTCTCTTCTGTCTCTTTCTCGAGAAAGAGACAGAAGAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013904.1-230s1c1
Sequence:CCGGGCTCAGTGATGAGGTCCAATTCTCGAGAATTGGACCTCATCACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013904.1-1657s1c1
Sequence:CCGGGCCAGAAAGATGAAGGGAAATCTCGAGATTTCCCTTCATCTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013904.1-263s1c1
Sequence:CCGGCCTCTCAGATTATGGCAAGAACTCGAGTTCTTGCCATAATCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks