EMAIL THIS PAGE TO A FRIEND

HFM1

HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)

Synonyms: MER3 RP11-539G11.1 SEC63D1 Si-11 Si-11-6 helicase
UniProtKB ID: A2PYH4, B1B0B6, Q8N9Q0
Gene ID:
Mouse(330149) HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)
Rat(690161) HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)
Zebrafish(557052) HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)
cow(505814) HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)
Horse(100051719) HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)
domestic cat(101096159) HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)
dog(479956) HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)
chicken(424509) HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)
sheep(101123510) HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)
Domestic Rabbit(100343911) HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)
domestic guinea pig(100718544) HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)
naked mole-rat(101700497) HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)
117 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017975 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017975 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017975 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_284117 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_284117 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_284117 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017975 Rosetta Predictions human pricing
XM_001073516 Rosetta Predictions rat pricing
NM_177873 Rosetta Predictions mouse pricing
XM_001475505 Rosetta Predictions mouse pricing
XM_987051 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306854 predicted 2605
2 SASI_Hs02_00306855 predicted 2766
3 SASI_Hs02_00306856 predicted 2255
4 SASI_Hs02_00306857 predicted 4084
5 SASI_Hs02_00306858 predicted 2199
6 SASI_Hs02_00306859 predicted 1791
7 SASI_Hs02_00306860 predicted 2753
8 SASI_Hs02_00306861 predicted 2095
9 SASI_Hs02_00306862 predicted 2934
10 SASI_Hs02_00306863 predicted 2436
11 SASI_Hs01_00239742 predicted 981
12 SASI_Hs01_00239743 predicted 449
13 SASI_Hs01_00239744 predicted 671
14 SASI_Hs01_00239745 predicted 1133
15 SASI_Hs01_00239746 predicted 1220
16 SASI_Hs01_00239747 predicted 1245
17 SASI_Hs01_00239748 predicted 1160
18 SASI_Hs01_00239749 predicted 980
19 SASI_Hs01_00239750 predicted 258
20 SASI_Hs01_00239751 predicted 1208
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073516 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343081 predicted 3653
2 SASI_Rn02_00343082 predicted 3705
3 SASI_Rn02_00343083 predicted 3718
4 SASI_Rn02_00343084 predicted 3846
5 SASI_Rn02_00343085 predicted 3779
6 SASI_Rn02_00343086 predicted 3823
7 SASI_Rn02_00343087 predicted 3728
8 SASI_Rn02_00343088 predicted 3690
9 SASI_Rn02_00343089 predicted 3695
10 SASI_Rn02_00343090 predicted 3621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149460 predicted 1163
2 SASI_Mm01_00149461 predicted 554
3 SASI_Mm01_00149462 predicted 543
4 SASI_Mm01_00149463 predicted 1124
5 SASI_Mm01_00149464 predicted 440
6 SASI_Mm01_00149465 predicted 668
7 SASI_Mm01_00149466 predicted 495
8 SASI_Mm01_00149467 predicted 1148
9 SASI_Mm01_00149468 predicted 1112
10 SASI_Mm01_00149469 predicted 750
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001475505 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00382997 predicted 3652
2 SASI_Mm02_00382998 predicted 3193
3 SASI_Mm02_00382999 predicted 2337
4 SASI_Mm02_00383000 predicted 1371
5 SASI_Mm02_00383001 predicted 3681
6 SASI_Mm02_00383002 predicted 3171
7 SASI_Mm02_00383003 predicted 2095
8 SASI_Mm02_00383004 predicted 1542
9 SASI_Mm02_00383005 predicted 2497
10 SASI_Mm02_00383006 predicted 2825
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_987051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202437 predicted 3652
2 SASI_Mm02_00449232 predicted 3194
3 SASI_Mm02_00449233 predicted 2336
4 SASI_Mm02_00449234 predicted 1371
5 SASI_Mm01_00202440 predicted 3678
6 SASI_Mm02_00449235 predicted 2100
7 SASI_Mm02_00449236 predicted 1536
8 SASI_Mm02_00449237 predicted 2499
9 SASI_Mm02_00449238 predicted 2828
10 SASI_Mm02_00449239 predicted 1553
11 SASI_Mm01_00202438 predicted 2227
12 SASI_Mm01_00202439 predicted 2290
13 SASI_Mm01_00202441 predicted 2194
14 SASI_Mm01_00202442 predicted 2473
15 SASI_Mm01_00202443 predicted 2397
16 SASI_Mm01_00202444 predicted 2375
17 SASI_Mm01_00202445 predicted 2471
18 SASI_Mm01_00202446 predicted 2249
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017975
HFM1 MISSION shRNA Bacterial Glycerol Stock
HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017975.1-182s1c1
Sequence:CCGGCTCAGGAGTTAGAGGAAGAATCTCGAGATTCTTCCTCTAACTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017975.1-1813s1c1
Sequence:CCGGGCTCCTCAATTCTGTATGCTTCTCGAGAAGCATACAGAATTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017975.1-1430s1c1
Sequence:CCGGGCTGAGGATGTGAGTTACAATCTCGAGATTGTAACTCACATCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017975.1-740s1c1
Sequence:CCGGGCATGTTCAAAGCACCATCTTCTCGAGAAGATGGTGCTTTGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017975.1-178s1c1
Sequence:CCGGGATACTCAGGAGTTAGAGGAACTCGAGTTCCTCTAACTCCTGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017975
HFM1 MISSION shRNA shRNA Plasmid DNA
HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017975.1-182s1c1
Sequence:CCGGCTCAGGAGTTAGAGGAAGAATCTCGAGATTCTTCCTCTAACTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017975.1-1813s1c1
Sequence:CCGGGCTCCTCAATTCTGTATGCTTCTCGAGAAGCATACAGAATTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017975.1-1430s1c1
Sequence:CCGGGCTGAGGATGTGAGTTACAATCTCGAGATTGTAACTCACATCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017975.1-740s1c1
Sequence:CCGGGCATGTTCAAAGCACCATCTTCTCGAGAAGATGGTGCTTTGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017975.1-178s1c1
Sequence:CCGGGATACTCAGGAGTTAGAGGAACTCGAGTTCCTCTAACTCCTGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017975
HFM1 MISSION shRNA Lentiviral Transduction Particles
HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017975.1-182s1c1
Sequence:CCGGCTCAGGAGTTAGAGGAAGAATCTCGAGATTCTTCCTCTAACTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017975.1-1813s1c1
Sequence:CCGGGCTCCTCAATTCTGTATGCTTCTCGAGAAGCATACAGAATTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017975.1-1430s1c1
Sequence:CCGGGCTGAGGATGTGAGTTACAATCTCGAGATTGTAACTCACATCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017975.1-740s1c1
Sequence:CCGGGCATGTTCAAAGCACCATCTTCTCGAGAAGATGGTGCTTTGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017975.1-178s1c1
Sequence:CCGGGATACTCAGGAGTTAGAGGAACTCGAGTTCCTCTAACTCCTGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_284117
HFM1 MISSION shRNA Bacterial Glycerol Stock
HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_284117.2-1267s1c1
Sequence:CCGGCACGTTCACTTTCAGAGATAACTCGAGTTATCTCTGAAAGTGAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284117.2-876s1c1
Sequence:CCGGCATATTCAAAGCACCATCATTCTCGAGAATGATGGTGCTTTGAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284117.2-811s1c1
Sequence:CCGGCGTCAGTATTCTACAAACAAACTCGAGTTTGTTTGTAGAATACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284117.2-744s1c1
Sequence:CCGGAGTGAAACTTACCCAAACGAACTCGAGTTCGTTTGGGTAAGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284117.2-740s1c1
Sequence:CCGGGCCCAGTGAAACTTACCCAAACTCGAGTTTGGGTAAGTTTCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_284117
HFM1 MISSION shRNA shRNA Plasmid DNA
HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_284117.2-1267s1c1
Sequence:CCGGCACGTTCACTTTCAGAGATAACTCGAGTTATCTCTGAAAGTGAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284117.2-876s1c1
Sequence:CCGGCATATTCAAAGCACCATCATTCTCGAGAATGATGGTGCTTTGAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284117.2-811s1c1
Sequence:CCGGCGTCAGTATTCTACAAACAAACTCGAGTTTGTTTGTAGAATACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284117.2-744s1c1
Sequence:CCGGAGTGAAACTTACCCAAACGAACTCGAGTTCGTTTGGGTAAGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284117.2-740s1c1
Sequence:CCGGGCCCAGTGAAACTTACCCAAACTCGAGTTTGGGTAAGTTTCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_284117
HFM1 MISSION shRNA Lentiviral Transduction Particles
HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_284117.2-1267s1c1
Sequence:CCGGCACGTTCACTTTCAGAGATAACTCGAGTTATCTCTGAAAGTGAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284117.2-876s1c1
Sequence:CCGGCATATTCAAAGCACCATCATTCTCGAGAATGATGGTGCTTTGAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284117.2-811s1c1
Sequence:CCGGCGTCAGTATTCTACAAACAAACTCGAGTTTGTTTGTAGAATACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284117.2-744s1c1
Sequence:CCGGAGTGAAACTTACCCAAACGAACTCGAGTTCGTTTGGGTAAGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284117.2-740s1c1
Sequence:CCGGGCCCAGTGAAACTTACCCAAACTCGAGTTTGGGTAAGTTTCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks