EMAIL THIS PAGE TO A FRIEND

HGC6.3

Species: Human HGC6.3(100128124)
Gene ID:
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001129895 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001129895 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001129895 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715171 Rosetta Predictions human pricing
XM_001720008 Rosetta Predictions human pricing
XM_001720159 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00401902 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00433992 predicted 578
2 SASI_Hs02_00433993 predicted 845
3 SASI_Hs02_00433994 predicted 526
4 SASI_Hs02_00433995 predicted 813
5 SASI_Hs02_00433996 predicted 525
6 SASI_Hs02_00433997 predicted 814
7 SASI_Hs02_00433998 predicted 528
8 SASI_Hs02_00433999 predicted 566
9 SASI_Hs02_00434000 predicted 833
10 SASI_Hs02_00434001 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00434951 predicted 45
2 SASI_Hs02_00434952 predicted 98
3 SASI_Hs02_00434953 predicted 45
4 SASI_Hs02_00434954 predicted 47
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001129895
HGC6.3 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129895.1-822s21c1
Sequence:CCGGGTGGTTTCTCTGGTCACTCACCTCGAGGTGAGTGACCAGAGAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129895.1-348s21c1
Sequence:CCGGTCCTCCTCCCAACACACTGCACTCGAGTGCAGTGTGTTGGGAGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129895.1-384s21c1
Sequence:CCGGACTGTCTTCTCCTCCCAACACCTCGAGGTGTTGGGAGGAGAAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129895.1-846s21c1
Sequence:CCGGCCAGCACTAGCACGCAGCAGTCTCGAGACTGCTGCGTGCTAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129895.1-834s21c1
Sequence:CCGGGTCACTCACGGTCCAGCACTACTCGAGTAGTGCTGGACCGTGAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001129895
HGC6.3 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129895.1-822s21c1
Sequence:CCGGGTGGTTTCTCTGGTCACTCACCTCGAGGTGAGTGACCAGAGAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129895.1-348s21c1
Sequence:CCGGTCCTCCTCCCAACACACTGCACTCGAGTGCAGTGTGTTGGGAGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129895.1-384s21c1
Sequence:CCGGACTGTCTTCTCCTCCCAACACCTCGAGGTGTTGGGAGGAGAAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129895.1-846s21c1
Sequence:CCGGCCAGCACTAGCACGCAGCAGTCTCGAGACTGCTGCGTGCTAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129895.1-834s21c1
Sequence:CCGGGTCACTCACGGTCCAGCACTACTCGAGTAGTGCTGGACCGTGAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001129895
HGC6.3 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129895.1-822s21c1
Sequence:CCGGGTGGTTTCTCTGGTCACTCACCTCGAGGTGAGTGACCAGAGAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129895.1-348s21c1
Sequence:CCGGTCCTCCTCCCAACACACTGCACTCGAGTGCAGTGTGTTGGGAGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129895.1-384s21c1
Sequence:CCGGACTGTCTTCTCCTCCCAACACCTCGAGGTGTTGGGAGGAGAAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129895.1-846s21c1
Sequence:CCGGCCAGCACTAGCACGCAGCAGTCTCGAGACTGCTGCGTGCTAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129895.1-834s21c1
Sequence:CCGGGTCACTCACGGTCCAGCACTACTCGAGTAGTGCTGGACCGTGAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks