EMAIL THIS PAGE TO A FRIEND

HHLA2

HERV-H LTR-associating 2

Synonyms: B7H7
Species: Human HHLA2(11148)
UniProtKB ID: Q9UM44, D3DN60, Q9NWQ6
Gene ID:
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007072 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079891 MISSION® esiRNA esiRNA human HHLA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007072 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342897 predicted 1255
2 SASI_Hs01_00064155 predicted 1423
3 SASI_Hs01_00064156 predicted 1313
4 SASI_Hs01_00064157 predicted 890
5 SASI_Hs02_00342898 predicted 930
6 SASI_Hs01_00064159 predicted 913
7 SASI_Hs01_00064161 predicted 1431
8 SASI_Hs01_00064162 predicted 531
9 SASI_Hs02_00342899 predicted 583
10 SASI_Hs02_00342900 predicted 599
11 SASI_Hs01_00064153 predicted 1008
12 SASI_Hs01_00064154 predicted 477
13 SASI_Hs01_00064158 predicted 787
14 SASI_Hs01_00064160 predicted 536
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007072
HHLA2 MISSION shRNA Bacterial Glycerol Stock
HERV-H LTR-associating 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007072.2-1424s1c1
Sequence:CCGGGCCAAGAAACAGCTTCCCATACTCGAGTATGGGAAGCTGTTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007072.2-2537s1c1
Sequence:CCGGGCTCTTAACTTCACCGCCTAACTCGAGTTAGGCGGTGAAGTTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136482    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007072.2-1878s1c1
Sequence:CCGGCCTGGATGTTAAGGATTCCAACTCGAGTTGGAATCCTTAACATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007072.2-2148s1c1
Sequence:CCGGCGGTTGTATCAGGGTAACCAACTCGAGTTGGTTACCCTGATACAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007072.2-2165s1c1
Sequence:CCGGCCAACTCGATTTGGGATGAATCTCGAGATTCATCCCAAATCGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007072.2-1435s1c1
Sequence:CCGGGCTTCCCATAACAAAGGCTTACTCGAGTAAGCCTTTGTTATGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007072.2-1436s1c1
Sequence:CCGGCTTCCCATAACAAAGGCTTATCTCGAGATAAGCCTTTGTTATGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007072.2-480s1c1
Sequence:CCGGCATATTCCCTTTGGCTTTCTTCTCGAGAAGAAAGCCAAAGGGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135009    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007072.2-1973s1c1
Sequence:CCGGCCACTAAGAATCTGGAAGAAACTCGAGTTTCTTCCAGATTCTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007072
HHLA2 MISSION shRNA shRNA Plasmid DNA
HERV-H LTR-associating 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007072.2-1424s1c1
Sequence:CCGGGCCAAGAAACAGCTTCCCATACTCGAGTATGGGAAGCTGTTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007072.2-2537s1c1
Sequence:CCGGGCTCTTAACTTCACCGCCTAACTCGAGTTAGGCGGTGAAGTTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136482    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007072.2-1878s1c1
Sequence:CCGGCCTGGATGTTAAGGATTCCAACTCGAGTTGGAATCCTTAACATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007072.2-2148s1c1
Sequence:CCGGCGGTTGTATCAGGGTAACCAACTCGAGTTGGTTACCCTGATACAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007072.2-2165s1c1
Sequence:CCGGCCAACTCGATTTGGGATGAATCTCGAGATTCATCCCAAATCGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007072.2-1435s1c1
Sequence:CCGGGCTTCCCATAACAAAGGCTTACTCGAGTAAGCCTTTGTTATGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007072.2-1436s1c1
Sequence:CCGGCTTCCCATAACAAAGGCTTATCTCGAGATAAGCCTTTGTTATGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007072.2-480s1c1
Sequence:CCGGCATATTCCCTTTGGCTTTCTTCTCGAGAAGAAAGCCAAAGGGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135009    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007072.2-1973s1c1
Sequence:CCGGCCACTAAGAATCTGGAAGAAACTCGAGTTTCTTCCAGATTCTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007072
HHLA2 MISSION shRNA Lentiviral Transduction Particles
HERV-H LTR-associating 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007072.2-1424s1c1
Sequence:CCGGGCCAAGAAACAGCTTCCCATACTCGAGTATGGGAAGCTGTTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007072.2-2537s1c1
Sequence:CCGGGCTCTTAACTTCACCGCCTAACTCGAGTTAGGCGGTGAAGTTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136482    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007072.2-1878s1c1
Sequence:CCGGCCTGGATGTTAAGGATTCCAACTCGAGTTGGAATCCTTAACATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007072.2-2148s1c1
Sequence:CCGGCGGTTGTATCAGGGTAACCAACTCGAGTTGGTTACCCTGATACAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007072.2-2165s1c1
Sequence:CCGGCCAACTCGATTTGGGATGAATCTCGAGATTCATCCCAAATCGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007072.2-1435s1c1
Sequence:CCGGGCTTCCCATAACAAAGGCTTACTCGAGTAAGCCTTTGTTATGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007072.2-1436s1c1
Sequence:CCGGCTTCCCATAACAAAGGCTTATCTCGAGATAAGCCTTTGTTATGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007072.2-480s1c1
Sequence:CCGGCATATTCCCTTTGGCTTTCTTCTCGAGAAGAAAGCCAAAGGGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135009    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007072.2-1973s1c1
Sequence:CCGGCCACTAAGAATCTGGAAGAAACTCGAGTTTCTTCCAGATTCTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks