EMAIL THIS PAGE TO A FRIEND

HIBADH

3-hydroxyisobutyrate dehydrogenase

Synonyms: NS5ATP1
UniProtKB ID: P31937, Q546Z2, Q9UDN3
Gene ID:
Human(11112) Summary: This gene encodes a mitochondrial 3-hydroxyisobutyrate dehydrogenase enzyme. The encoded protein plays a critical role in the catabolism of L-valine by catalyzing the oxidation of 3-hydroxyisobutyrate to methylmalonate semialdehyde. [provided by RefSeq, Nov 2011]
Mouse(58875) 3-hydroxyisobutyrate dehydrogenase
Rat(63938) 3-hydroxyisobutyrate dehydrogenase
chicken(420632) 3-hydroxyisobutyrate dehydrogenase
cow(512002) 3-hydroxyisobutyrate dehydrogenase
Horse(100054707) 3-hydroxyisobutyrate dehydrogenase
domestic cat(101080519) 3-hydroxyisobutyrate dehydrogenase
dog(479610) 3-hydroxyisobutyrate dehydrogenase
sheep(101113492) 3-hydroxyisobutyrate dehydrogenase
domestic guinea pig(100718204) 3-hydroxyisobutyrate dehydrogenase
naked mole-rat(101705721) 3-hydroxyisobutyrate dehydrogenase
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152740 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152740 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152740 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145567 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145567 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145567 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152740 Rosetta Predictions human pricing
NM_022243 Rosetta Predictions rat pricing
NM_145567 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061462 predicted 425
2 SASI_Hs01_00061464 predicted 502
3 SASI_Hs01_00061465 predicted 520
4 SASI_Hs01_00061466 predicted 708
5 SASI_Hs01_00061467 predicted 593
6 SASI_Hs02_00366657 predicted 846
7 SASI_Hs01_00061468 predicted 837
8 SASI_Hs01_00061469 predicted 958
9 SASI_Hs01_00061470 predicted 195
10 SASI_Hs01_00061471 predicted 810
11 SASI_Hs01_00061463 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097482 predicted 422
2 SASI_Rn01_00097483 predicted 394
3 SASI_Rn01_00097484 predicted 343
4 SASI_Rn01_00097485 predicted 257
5 SASI_Rn01_00097486 predicted 669
6 SASI_Rn02_00263017 predicted 1083
7 SASI_Rn01_00097487 predicted 1113
8 SASI_Rn01_00097488 predicted 948
9 SASI_Rn01_00097489 predicted 1026
10 SASI_Rn01_00097490 predicted 241
11 SASI_Rn01_00097481 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145567 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120340 predicted 438
2 SASI_Mm01_00120341 predicted 1115
3 SASI_Mm01_00120342 predicted 865
4 SASI_Mm01_00120343 predicted 1119
5 SASI_Mm02_00341076 predicted 375
6 SASI_Mm01_00120344 predicted 1087
7 SASI_Mm01_00120345 predicted 635
8 SASI_Mm01_00120346 predicted 239
9 SASI_Mm01_00120347 predicted 963
10 SASI_Mm01_00120348 predicted 340
11 SASI_Mm01_00120349 predicted 562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152740
HIBADH MISSION shRNA Bacterial Glycerol Stock
3-hydroxyisobutyrate dehydrogenase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152740.2-505s1c1
Sequence:CCGGCCCACCAGTATCAATGCAATACTCGAGTATTGCATTGATACTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152740.2-536s1c1
Sequence:CCGGCCGGAGCAAATGGGATTCTAACTCGAGTTAGAATCCCATTTGCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152740.2-1138s1c1
Sequence:CCGGGCAAAGGGCTACTCAAAGAAACTCGAGTTTCTTTGAGTAGCCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152740.2-593s1c1
Sequence:CCGGGCACTATTGATCCTGCAGTTTCTCGAGAAACTGCAGGATCAATAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152740.2-1004s1c1
Sequence:CCGGCTAATAACTATCAGGGTGGATCTCGAGATCCACCCTGATAGTTATTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152740.2-696s21c1
Sequence:CCGGATCTGGGAACCTCACGTTTATCTCGAGATAAACGTGAGGTTCCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152740.2-1419s21c1
Sequence:CCGGGTCTCTGCTAACTAGCTTAATCTCGAGATTAAGCTAGTTAGCAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152740.2-831s21c1
Sequence:CCGCCAACATGCTGTTAGCTATTAGCTCGAGCTAATAGCTAACAGCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152740
HIBADH MISSION shRNA shRNA Plasmid DNA
3-hydroxyisobutyrate dehydrogenase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152740.2-505s1c1
Sequence:CCGGCCCACCAGTATCAATGCAATACTCGAGTATTGCATTGATACTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152740.2-536s1c1
Sequence:CCGGCCGGAGCAAATGGGATTCTAACTCGAGTTAGAATCCCATTTGCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152740.2-1138s1c1
Sequence:CCGGGCAAAGGGCTACTCAAAGAAACTCGAGTTTCTTTGAGTAGCCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152740.2-593s1c1
Sequence:CCGGGCACTATTGATCCTGCAGTTTCTCGAGAAACTGCAGGATCAATAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152740.2-1004s1c1
Sequence:CCGGCTAATAACTATCAGGGTGGATCTCGAGATCCACCCTGATAGTTATTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152740.2-696s21c1
Sequence:CCGGATCTGGGAACCTCACGTTTATCTCGAGATAAACGTGAGGTTCCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152740.2-1419s21c1
Sequence:CCGGGTCTCTGCTAACTAGCTTAATCTCGAGATTAAGCTAGTTAGCAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152740.2-831s21c1
Sequence:CCGCCAACATGCTGTTAGCTATTAGCTCGAGCTAATAGCTAACAGCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152740
HIBADH MISSION shRNA Lentiviral Transduction Particles
3-hydroxyisobutyrate dehydrogenase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152740.2-505s1c1
Sequence:CCGGCCCACCAGTATCAATGCAATACTCGAGTATTGCATTGATACTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152740.2-536s1c1
Sequence:CCGGCCGGAGCAAATGGGATTCTAACTCGAGTTAGAATCCCATTTGCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152740.2-1138s1c1
Sequence:CCGGGCAAAGGGCTACTCAAAGAAACTCGAGTTTCTTTGAGTAGCCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152740.2-593s1c1
Sequence:CCGGGCACTATTGATCCTGCAGTTTCTCGAGAAACTGCAGGATCAATAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152740.2-1004s1c1
Sequence:CCGGCTAATAACTATCAGGGTGGATCTCGAGATCCACCCTGATAGTTATTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152740.2-696s21c1
Sequence:CCGGATCTGGGAACCTCACGTTTATCTCGAGATAAACGTGAGGTTCCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152740.2-1419s21c1
Sequence:CCGGGTCTCTGCTAACTAGCTTAATCTCGAGATTAAGCTAGTTAGCAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152740.2-831s21c1
Sequence:CCGCCAACATGCTGTTAGCTATTAGCTCGAGCTAATAGCTAACAGCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145567
VALIDATED
HIBADH MISSION shRNA Bacterial Glycerol Stock
3-hydroxyisobutyrate dehydrogenase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145567.1-1189s1c1
Sequence:CCGGCCTGGGAATTTCTATCCATTTCTCGAGAAATGGATAGAAATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145567.1-262s1c1
Sequence:CCGGCCCTGATGTATGCAAGGAGTTCTCGAGAACTCCTTGCATACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145567.1-136s1c1
Sequence:CCGGAGCGGTGTGTTCTAGGTCAATCTCGAGATTGACCTAGAACACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145567.1-390s1c1
Sequence:CCGGCTGGAGCAAACGGGATTCTAACTCGAGTTAGAATCCCGTTTGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145567.1-851s1c1
Sequence:CCGGCCCTCATCCAATAACTACCAACTCGAGTTGGTAGTTATTGGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145567.1-851s21c1
Sequence:CCGGCCCTCATCCAATAACTACCAACTCGAGTTGGTAGTTATTGGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145567.1-1189s21c1
Sequence:CCGGCCTGGGAATTTCTATCCATTTCTCGAGAAATGGATAGAAATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145567.1-136s21c1
Sequence:CCGGAGCGGTGTGTTCTAGGTCAATCTCGAGATTGACCTAGAACACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145567.1-262s21c1
Sequence:CCGGCCCTGATGTATGCAAGGAGTTCTCGAGAACTCCTTGCATACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145567.1-390s21c1
Sequence:CCGGCTGGAGCAAACGGGATTCTAACTCGAGTTAGAATCCCGTTTGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145567
VALIDATED
HIBADH MISSION shRNA shRNA Plasmid DNA
3-hydroxyisobutyrate dehydrogenase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145567.1-1189s1c1
Sequence:CCGGCCTGGGAATTTCTATCCATTTCTCGAGAAATGGATAGAAATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145567.1-262s1c1
Sequence:CCGGCCCTGATGTATGCAAGGAGTTCTCGAGAACTCCTTGCATACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145567.1-136s1c1
Sequence:CCGGAGCGGTGTGTTCTAGGTCAATCTCGAGATTGACCTAGAACACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145567.1-390s1c1
Sequence:CCGGCTGGAGCAAACGGGATTCTAACTCGAGTTAGAATCCCGTTTGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145567.1-851s1c1
Sequence:CCGGCCCTCATCCAATAACTACCAACTCGAGTTGGTAGTTATTGGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145567.1-851s21c1
Sequence:CCGGCCCTCATCCAATAACTACCAACTCGAGTTGGTAGTTATTGGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145567.1-1189s21c1
Sequence:CCGGCCTGGGAATTTCTATCCATTTCTCGAGAAATGGATAGAAATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145567.1-136s21c1
Sequence:CCGGAGCGGTGTGTTCTAGGTCAATCTCGAGATTGACCTAGAACACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145567.1-262s21c1
Sequence:CCGGCCCTGATGTATGCAAGGAGTTCTCGAGAACTCCTTGCATACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145567.1-390s21c1
Sequence:CCGGCTGGAGCAAACGGGATTCTAACTCGAGTTAGAATCCCGTTTGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145567
VALIDATED
HIBADH MISSION shRNA Lentiviral Transduction Particles
3-hydroxyisobutyrate dehydrogenase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145567.1-1189s1c1
Sequence:CCGGCCTGGGAATTTCTATCCATTTCTCGAGAAATGGATAGAAATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145567.1-262s1c1
Sequence:CCGGCCCTGATGTATGCAAGGAGTTCTCGAGAACTCCTTGCATACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145567.1-136s1c1
Sequence:CCGGAGCGGTGTGTTCTAGGTCAATCTCGAGATTGACCTAGAACACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145567.1-390s1c1
Sequence:CCGGCTGGAGCAAACGGGATTCTAACTCGAGTTAGAATCCCGTTTGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145567.1-851s1c1
Sequence:CCGGCCCTCATCCAATAACTACCAACTCGAGTTGGTAGTTATTGGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145567.1-851s21c1
Sequence:CCGGCCCTCATCCAATAACTACCAACTCGAGTTGGTAGTTATTGGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145567.1-1189s21c1
Sequence:CCGGCCTGGGAATTTCTATCCATTTCTCGAGAAATGGATAGAAATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145567.1-136s21c1
Sequence:CCGGAGCGGTGTGTTCTAGGTCAATCTCGAGATTGACCTAGAACACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145567.1-262s21c1
Sequence:CCGGCCCTGATGTATGCAAGGAGTTCTCGAGAACTCCTTGCATACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145567.1-390s21c1
Sequence:CCGGCTGGAGCAAACGGGATTCTAACTCGAGTTAGAATCCCGTTTGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks