EMAIL THIS PAGE TO A FRIEND

HIC2

hypermethylated in cancer 2

Synonyms: HRG22 ZBTB30 ZNF907
UniProtKB ID: Q96JB3, Q504T6, Q96KR3, Q9NSM9, Q9UPX9
Gene ID:
Mouse(58180) hypermethylated in cancer 2
Rat(287940) hypermethylated in cancer 2
Zebrafish(359828) hypermethylated in cancer 2
cow(539541) hypermethylated in cancer 2
Horse(100051007) hypermethylated in cancer 2
dog(486444) hypermethylated in cancer 2
chicken(416768) hypermethylated in cancer 2
domestic guinea pig(100733174) hypermethylated in cancer 2
naked mole-rat(101700508) hypermethylated in cancer 2
178 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015094 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015094 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015094 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015094 Rosetta Predictions human pricing
NM_001105862 Rosetta Predictions rat pricing
NM_178922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014766 predicted 1730
2 SASI_Hs01_00014768 predicted 1200
3 SASI_Hs01_00014769 predicted 1584
4 SASI_Hs01_00014770 predicted 1550
5 SASI_Hs01_00014771 predicted 1519
6 SASI_Hs02_00346979 predicted 411
7 SASI_Hs02_00346980 predicted 1090
8 SASI_Hs01_00014772 predicted 498
9 SASI_Hs01_00014773 predicted 815
10 SASI_Hs01_00014774 predicted 426
11 SASI_Hs01_00014765 predicted 1094
12 SASI_Hs01_00014767 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105862 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213262 predicted 411
2 SASI_Rn02_00213263 predicted 1509
3 SASI_Rn02_00213264 predicted 1730
4 SASI_Rn02_00213265 predicted 1626
5 SASI_Rn02_00213266 predicted 2138
6 SASI_Rn02_00213267 predicted 1984
7 SASI_Rn02_00213268 predicted 1527
8 SASI_Rn02_00213269 predicted 2233
9 SASI_Rn02_00213270 predicted 1128
10 SASI_Rn02_00213271 predicted 1338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168408 predicted 1620
2 SASI_Mm01_00168409 predicted 1272
3 SASI_Mm01_00168410 predicted 744
4 SASI_Mm01_00168411 predicted 1519
5 SASI_Mm01_00168412 predicted 2122
6 SASI_Mm01_00168413 predicted 1714
7 SASI_Mm01_00168414 predicted 1483
8 SASI_Mm01_00168415 predicted 554
9 SASI_Mm01_00168416 predicted 372
10 SASI_Mm01_00168417 predicted 2153
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178922
HIC2 MISSION shRNA Bacterial Glycerol Stock
hypermethylated in cancer 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178922.3-447s21c1
Sequence:CCGGATGATAACCTCATCAACTTAGCTCGAGCTAAGTTGATGAGGTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178922.3-1619s21c1
Sequence:CCGGCACACGGAGGAGGAGTTATTCCTCGAGGAATAACTCCTCCTCCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178922.3-2964s21c1
Sequence:CCGGCCTTGTTAGAGGTACTTATTTCTCGAGAAATAAGTACCTCTAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178922.3-1085s21c1
Sequence:CCGGGTCGGCAATAGTGCCTCATTTCTCGAGAAATGAGGCACTATTGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178922.3-723s21c1
Sequence:CCGGCTGTCATCCAGGCTCGATTTCCTCGAGGAAATCGAGCCTGGATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178922.3-2963s1c1
Sequence:CCGGCCCTTGTTAGAGGTACTTATTCTCGAGAATAAGTACCTCTAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178922.3-1831s1c1
Sequence:CCGGCTGCAACATTTGTGGAAAGATCTCGAGATCTTTCCACAAATGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178922.3-442s1c1
Sequence:CCGGCCTGCATGATAACCTCATCAACTCGAGTTGATGAGGTTATCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178922.3-1631s1c1
Sequence:CCGGGAGTTATTCATCAAGGAAGAACTCGAGTTCTTCCTTGATGAATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178922.3-1085s1c1
Sequence:CCGGGTCGGCAATAGTGCCTCATTTCTCGAGAAATGAGGCACTATTGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178922
HIC2 MISSION shRNA shRNA Plasmid DNA
hypermethylated in cancer 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178922.3-447s21c1
Sequence:CCGGATGATAACCTCATCAACTTAGCTCGAGCTAAGTTGATGAGGTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178922.3-1619s21c1
Sequence:CCGGCACACGGAGGAGGAGTTATTCCTCGAGGAATAACTCCTCCTCCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178922.3-2964s21c1
Sequence:CCGGCCTTGTTAGAGGTACTTATTTCTCGAGAAATAAGTACCTCTAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178922.3-1085s21c1
Sequence:CCGGGTCGGCAATAGTGCCTCATTTCTCGAGAAATGAGGCACTATTGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178922.3-723s21c1
Sequence:CCGGCTGTCATCCAGGCTCGATTTCCTCGAGGAAATCGAGCCTGGATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178922.3-2963s1c1
Sequence:CCGGCCCTTGTTAGAGGTACTTATTCTCGAGAATAAGTACCTCTAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178922.3-1831s1c1
Sequence:CCGGCTGCAACATTTGTGGAAAGATCTCGAGATCTTTCCACAAATGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178922.3-442s1c1
Sequence:CCGGCCTGCATGATAACCTCATCAACTCGAGTTGATGAGGTTATCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178922.3-1631s1c1
Sequence:CCGGGAGTTATTCATCAAGGAAGAACTCGAGTTCTTCCTTGATGAATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178922.3-1085s1c1
Sequence:CCGGGTCGGCAATAGTGCCTCATTTCTCGAGAAATGAGGCACTATTGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178922
HIC2 MISSION shRNA Lentiviral Transduction Particles
hypermethylated in cancer 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178922.3-447s21c1
Sequence:CCGGATGATAACCTCATCAACTTAGCTCGAGCTAAGTTGATGAGGTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178922.3-1619s21c1
Sequence:CCGGCACACGGAGGAGGAGTTATTCCTCGAGGAATAACTCCTCCTCCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178922.3-2964s21c1
Sequence:CCGGCCTTGTTAGAGGTACTTATTTCTCGAGAAATAAGTACCTCTAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178922.3-1085s21c1
Sequence:CCGGGTCGGCAATAGTGCCTCATTTCTCGAGAAATGAGGCACTATTGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178922.3-723s21c1
Sequence:CCGGCTGTCATCCAGGCTCGATTTCCTCGAGGAAATCGAGCCTGGATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178922.3-2963s1c1
Sequence:CCGGCCCTTGTTAGAGGTACTTATTCTCGAGAATAAGTACCTCTAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178922.3-1831s1c1
Sequence:CCGGCTGCAACATTTGTGGAAAGATCTCGAGATCTTTCCACAAATGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178922.3-442s1c1
Sequence:CCGGCCTGCATGATAACCTCATCAACTCGAGTTGATGAGGTTATCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178922.3-1631s1c1
Sequence:CCGGGAGTTATTCATCAAGGAAGAACTCGAGTTCTTCCTTGATGAATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178922.3-1085s1c1
Sequence:CCGGGTCGGCAATAGTGCCTCATTTCTCGAGAAATGAGGCACTATTGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015094
VALIDATED
HIC2 MISSION shRNA Bacterial Glycerol Stock
hypermethylated in cancer 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_015094.2-736s21c1
Sequence:CCGGCTGTCATCCAAGCTCGGTATCCTCGAGGATACCGAGCTTGGATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015094.2-4407s21c1
Sequence:CCGGACGTTTGTGCGACATAGTATTCTCGAGAATACTATGTCGCACAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015094.2-1747s21c1
Sequence:CCGGAGTGTTCGGTCTGCGAGAAGACTCGAGTCTTCTCGCAGACCGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015094.2-422s21c1
Sequence:CCGGAGCCGCCAGCAGCATCTATTTCTCGAGAAATAGATGCTGCTGGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_015094.2-1097s21c1
Sequence:CCGGTGCCAACAGTGCCTCTTATTCCTCGAGGAATAAGAGGCACTGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015094.1-6240s1c1
Sequence:CCGGCCTTGCTATTTATTGCTGTAACTCGAGTTACAGCAATAAATAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015094.1-1220s1c1
Sequence:CCGGCCGGCACTCCACTCGGAAGAACTCGAGTTCTTCCGAGTGGAGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_015094.1-425s1c1
Sequence:CCGGCGCCAGCAGCATCTATTTCAACTCGAGTTGAAATAGATGCTGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015094.1-1931s1c1
Sequence:CCGGCATGCGCTTCACCCGTCAGTACTCGAGTACTGACGGGTGAAGCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015094
VALIDATED
HIC2 MISSION shRNA shRNA Plasmid DNA
hypermethylated in cancer 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_015094.2-736s21c1
Sequence:CCGGCTGTCATCCAAGCTCGGTATCCTCGAGGATACCGAGCTTGGATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015094.2-4407s21c1
Sequence:CCGGACGTTTGTGCGACATAGTATTCTCGAGAATACTATGTCGCACAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015094.2-1747s21c1
Sequence:CCGGAGTGTTCGGTCTGCGAGAAGACTCGAGTCTTCTCGCAGACCGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015094.2-422s21c1
Sequence:CCGGAGCCGCCAGCAGCATCTATTTCTCGAGAAATAGATGCTGCTGGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_015094.2-1097s21c1
Sequence:CCGGTGCCAACAGTGCCTCTTATTCCTCGAGGAATAAGAGGCACTGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015094.1-6240s1c1
Sequence:CCGGCCTTGCTATTTATTGCTGTAACTCGAGTTACAGCAATAAATAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015094.1-1220s1c1
Sequence:CCGGCCGGCACTCCACTCGGAAGAACTCGAGTTCTTCCGAGTGGAGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_015094.1-425s1c1
Sequence:CCGGCGCCAGCAGCATCTATTTCAACTCGAGTTGAAATAGATGCTGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015094.1-1931s1c1
Sequence:CCGGCATGCGCTTCACCCGTCAGTACTCGAGTACTGACGGGTGAAGCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015094
VALIDATED
HIC2 MISSION shRNA Lentiviral Transduction Particles
hypermethylated in cancer 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_015094.2-736s21c1
Sequence:CCGGCTGTCATCCAAGCTCGGTATCCTCGAGGATACCGAGCTTGGATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015094.2-4407s21c1
Sequence:CCGGACGTTTGTGCGACATAGTATTCTCGAGAATACTATGTCGCACAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015094.2-1747s21c1
Sequence:CCGGAGTGTTCGGTCTGCGAGAAGACTCGAGTCTTCTCGCAGACCGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015094.2-422s21c1
Sequence:CCGGAGCCGCCAGCAGCATCTATTTCTCGAGAAATAGATGCTGCTGGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_015094.2-1097s21c1
Sequence:CCGGTGCCAACAGTGCCTCTTATTCCTCGAGGAATAAGAGGCACTGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015094.1-6240s1c1
Sequence:CCGGCCTTGCTATTTATTGCTGTAACTCGAGTTACAGCAATAAATAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015094.1-1220s1c1
Sequence:CCGGCCGGCACTCCACTCGGAAGAACTCGAGTTCTTCCGAGTGGAGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_015094.1-425s1c1
Sequence:CCGGCGCCAGCAGCATCTATTTCAACTCGAGTTGAAATAGATGCTGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015094.1-1931s1c1
Sequence:CCGGCATGCGCTTCACCCGTCAGTACTCGAGTACTGACGGGTGAAGCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks