EMAIL THIS PAGE TO A FRIEND

HIF3A

hypoxia inducible factor 3, alpha subunit

Synonyms: HIF-3A IPAS MOP7 PASD7 bHLHe17
Gene ID:
Human(64344) Summary: The protein encoded by this gene is the alpha-3 subunit of one of several alpha/beta-subunit heterodimeric transcription factors that regulate many adaptive responses to low oxygen tension (hypoxia). The alpha-3 subunit lacks the transactivation domain found in factors containing either the alpha-1 or alpha-2 subunits. It is thought that factors containing the alpha-3 subunit are negative regulators of hypoxia-inducible gene expression. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]
Mouse(53417) hypoxia inducible factor 3, alpha subunit
Rat(64345) hypoxia inducible factor 3, alpha subunit
cow(507699) hypoxia inducible factor 3, alpha subunit
Horse(100071095) hypoxia inducible factor 3, alpha subunit
domestic cat(101091575) hypoxia inducible factor 3, alpha subunit
dog(476429) hypoxia inducible factor 3, alpha subunit
domestic guinea pig(100725178) hypoxia inducible factor 3, alpha subunit
naked mole-rat(101697834) hypoxia inducible factor 3, alpha subunit
sheep(100135687) hypoxia inducible factor 3, alpha subunit
258 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016868 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016868 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016868 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022462 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022462 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022462 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022462 Rosetta Predictions human pricing
NM_152794 Rosetta Predictions human pricing
NM_152795 Rosetta Predictions human pricing
NM_022528 Rosetta Predictions rat pricing
NM_016868 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069934 predicted 2368
2 SASI_Hs01_00069935 predicted 1507
3 SASI_Hs01_00069936 predicted 2508
4 SASI_Hs01_00069937 predicted 2497
5 SASI_Hs01_00069938 predicted 869
6 SASI_Hs01_00069939 predicted 1075
7 SASI_Hs01_00069940 predicted 448
8 SASI_Hs01_00069941 predicted 1502
9 SASI_Hs01_00069942 predicted 838
10 SASI_Hs01_00069943 predicted 2546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130431 predicted 2328
2 SASI_Hs01_00130432 predicted 1461
3 SASI_Hs01_00130433 predicted 2458
4 SASI_Hs01_00130434 predicted 2449
5 SASI_Hs01_00130435 predicted 824
6 SASI_Hs01_00130436 predicted 1034
7 SASI_Hs01_00130437 predicted 408
8 SASI_Hs01_00130438 predicted 1455
9 SASI_Hs01_00130439 predicted 798
10 SASI_Hs01_00130440 predicted 2498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152795 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040045 predicted 2311
2 SASI_Hs01_00040046 predicted 1441
3 SASI_Hs01_00040047 predicted 2444
4 SASI_Hs01_00040048 predicted 2433
5 SASI_Hs01_00040049 predicted 814
6 SASI_Hs01_00040050 predicted 1023
7 SASI_Hs01_00040051 predicted 396
8 SASI_Hs01_00040052 predicted 1447
9 SASI_Hs01_00040053 predicted 782
10 SASI_Hs01_00040054 predicted 2484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056435 predicted 1401
2 SASI_Rn01_00056436 predicted 925
3 SASI_Rn01_00056437 predicted 434
4 SASI_Rn01_00056438 predicted 1019
5 SASI_Rn01_00056439 predicted 799
6 SASI_Rn01_00056440 predicted 1364
7 SASI_Rn01_00056441 predicted 361
8 SASI_Rn01_00056442 predicted 870
9 SASI_Rn01_00056443 predicted 828
10 SASI_Rn02_00263276 predicted 882
11 SASI_Rn01_00056434 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323658 predicted 1482
2 SASI_Mm01_00071825 predicted 1003
3 SASI_Mm01_00071827 predicted 881
4 SASI_Mm01_00071828 predicted 197
5 SASI_Mm01_00071829 predicted 439
6 SASI_Mm02_00323659 predicted 479
7 SASI_Mm01_00071831 predicted 1099
8 SASI_Mm01_00071833 predicted 232
9 SASI_Mm01_00071834 predicted 1191
10 SASI_Mm02_00323660 predicted 383
11 SASI_Mm01_00071826 predicted 1904
12 SASI_Mm01_00071830 predicted 1477
13 SASI_Mm01_00071832 predicted 1569
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016868
HIF3A MISSION shRNA Bacterial Glycerol Stock
hypoxia inducible factor 3, alpha subunit
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016868.3-2435s21c1
Sequence:CCGGTAGACAACTGTAATCACATTTCTCGAGAAATGTGATTACAGTTGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016868.3-433s21c1
Sequence:CCGGTCAGTCAGCTGGAGCTCATTGCTCGAGCAATGAGCTCCAGCTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016868.3-1571s21c1
Sequence:CCGGGCTCAACTCCAGCGAGCAATTCTCGAGAATTGCTCGCTGGAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016868.3-837s21c1
Sequence:CCGGTGCGACGAGAGGATTGCAGAACTCGAGTTCTGCAATCCTCTCGTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016868.1-899s1c1
Sequence:CCGGCTATGAATACATCCACGCTTTCTCGAGAAAGCGTGGATGTATTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016868.1-391s1c1
Sequence:CCGGACATGGCTTACCTGTCGGAAACTCGAGTTTCCGACAGGTAAGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016868.1-1571s1c1
Sequence:CCGGGCTCAACTCCAGTGAGCAATTCTCGAGAATTGCTCACTGGAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016868.1-1820s1c1
Sequence:CCGGGCTGGAAATTAAGCCTCCCAACTCGAGTTGGGAGGCTTAATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016868
HIF3A MISSION shRNA shRNA Plasmid DNA
hypoxia inducible factor 3, alpha subunit
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016868.3-2435s21c1
Sequence:CCGGTAGACAACTGTAATCACATTTCTCGAGAAATGTGATTACAGTTGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016868.3-433s21c1
Sequence:CCGGTCAGTCAGCTGGAGCTCATTGCTCGAGCAATGAGCTCCAGCTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016868.3-1571s21c1
Sequence:CCGGGCTCAACTCCAGCGAGCAATTCTCGAGAATTGCTCGCTGGAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016868.3-837s21c1
Sequence:CCGGTGCGACGAGAGGATTGCAGAACTCGAGTTCTGCAATCCTCTCGTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016868.1-899s1c1
Sequence:CCGGCTATGAATACATCCACGCTTTCTCGAGAAAGCGTGGATGTATTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016868.1-391s1c1
Sequence:CCGGACATGGCTTACCTGTCGGAAACTCGAGTTTCCGACAGGTAAGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016868.1-1571s1c1
Sequence:CCGGGCTCAACTCCAGTGAGCAATTCTCGAGAATTGCTCACTGGAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016868.1-1820s1c1
Sequence:CCGGGCTGGAAATTAAGCCTCCCAACTCGAGTTGGGAGGCTTAATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016868
HIF3A MISSION shRNA Lentiviral Transduction Particles
hypoxia inducible factor 3, alpha subunit
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016868.3-2435s21c1
Sequence:CCGGTAGACAACTGTAATCACATTTCTCGAGAAATGTGATTACAGTTGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016868.3-433s21c1
Sequence:CCGGTCAGTCAGCTGGAGCTCATTGCTCGAGCAATGAGCTCCAGCTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016868.3-1571s21c1
Sequence:CCGGGCTCAACTCCAGCGAGCAATTCTCGAGAATTGCTCGCTGGAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016868.3-837s21c1
Sequence:CCGGTGCGACGAGAGGATTGCAGAACTCGAGTTCTGCAATCCTCTCGTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016868.1-899s1c1
Sequence:CCGGCTATGAATACATCCACGCTTTCTCGAGAAAGCGTGGATGTATTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016868.1-391s1c1
Sequence:CCGGACATGGCTTACCTGTCGGAAACTCGAGTTTCCGACAGGTAAGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016868.1-1571s1c1
Sequence:CCGGGCTCAACTCCAGTGAGCAATTCTCGAGAATTGCTCACTGGAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016868.1-1820s1c1
Sequence:CCGGGCTGGAAATTAAGCCTCCCAACTCGAGTTGGGAGGCTTAATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022462
HIF3A MISSION shRNA Bacterial Glycerol Stock
hypoxia inducible factor 3, alpha subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022462.3-2489s21c1
Sequence:CCGGCGGGTCAACGTGATCACATTTCTCGAGAAATGTGATCACGTTGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022462.3-1502s21c1
Sequence:CCGGTGGAGACAGATTTAGATATAGCTCGAGCTATATCTAAATCTGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022462.3-404s21c1
Sequence:CCGGTGGCTTACCTGTCGGAGAATGCTCGAGCATTCTCCGACAGGTAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022462.3-2367s21c1
Sequence:CCGGATACTTGGTTACCTCATTATCCTCGAGGATAATGAGGTAACCAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022462.x-1498s1c1
Sequence:CCGGGCAGTGGAGACAGATTTAGATCTCGAGATCTAAATCTGTCTCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022462.x-403s1c1
Sequence:CCGGATGGCTTACCTGTCGGAGAATCTCGAGATTCTCCGACAGGTAAGCCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022462.x-1510s1c1
Sequence:CCGGGATTTAGATATAGCTCAGGATCTCGAGATCCTGAGCTATATCTAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022462.x-1083s1c1
Sequence:CCGGGAGTATCGTCTGTGTCCATTTCTCGAGAAATGGACACAGACGATACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022462.x-941s1c1
Sequence:CCGGCGGTCAGCAAGAGCATCCACACTCGAGTGTGGATGCTCTTGCTGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022462
HIF3A MISSION shRNA shRNA Plasmid DNA
hypoxia inducible factor 3, alpha subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022462.3-2489s21c1
Sequence:CCGGCGGGTCAACGTGATCACATTTCTCGAGAAATGTGATCACGTTGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022462.3-1502s21c1
Sequence:CCGGTGGAGACAGATTTAGATATAGCTCGAGCTATATCTAAATCTGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022462.3-404s21c1
Sequence:CCGGTGGCTTACCTGTCGGAGAATGCTCGAGCATTCTCCGACAGGTAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022462.3-2367s21c1
Sequence:CCGGATACTTGGTTACCTCATTATCCTCGAGGATAATGAGGTAACCAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022462.x-1498s1c1
Sequence:CCGGGCAGTGGAGACAGATTTAGATCTCGAGATCTAAATCTGTCTCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022462.x-403s1c1
Sequence:CCGGATGGCTTACCTGTCGGAGAATCTCGAGATTCTCCGACAGGTAAGCCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022462.x-1510s1c1
Sequence:CCGGGATTTAGATATAGCTCAGGATCTCGAGATCCTGAGCTATATCTAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022462.x-1083s1c1
Sequence:CCGGGAGTATCGTCTGTGTCCATTTCTCGAGAAATGGACACAGACGATACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022462.x-941s1c1
Sequence:CCGGCGGTCAGCAAGAGCATCCACACTCGAGTGTGGATGCTCTTGCTGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022462
HIF3A MISSION shRNA Lentiviral Transduction Particles
hypoxia inducible factor 3, alpha subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022462.3-2489s21c1
Sequence:CCGGCGGGTCAACGTGATCACATTTCTCGAGAAATGTGATCACGTTGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022462.3-1502s21c1
Sequence:CCGGTGGAGACAGATTTAGATATAGCTCGAGCTATATCTAAATCTGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022462.3-404s21c1
Sequence:CCGGTGGCTTACCTGTCGGAGAATGCTCGAGCATTCTCCGACAGGTAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022462.3-2367s21c1
Sequence:CCGGATACTTGGTTACCTCATTATCCTCGAGGATAATGAGGTAACCAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022462.x-1498s1c1
Sequence:CCGGGCAGTGGAGACAGATTTAGATCTCGAGATCTAAATCTGTCTCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022462.x-403s1c1
Sequence:CCGGATGGCTTACCTGTCGGAGAATCTCGAGATTCTCCGACAGGTAAGCCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022462.x-1510s1c1
Sequence:CCGGGATTTAGATATAGCTCAGGATCTCGAGATCCTGAGCTATATCTAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022462.x-1083s1c1
Sequence:CCGGGAGTATCGTCTGTGTCCATTTCTCGAGAAATGGACACAGACGATACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022462.x-941s1c1
Sequence:CCGGCGGTCAGCAAGAGCATCCACACTCGAGTGTGGATGCTCTTGCTGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks