EMAIL THIS PAGE TO A FRIEND

HIGD1B

HIG1 hypoxia inducible domain family, member 1B

Synonyms: CLST11240 CLST11240-15
UniProtKB ID: Q9P298, D3DX57, Q9P297
Gene ID:
Human(51751) Summary: This gene encodes a member of the hypoxia inducible gene 1 (HIG1) domain family. The encoded protein is localized to the cell membrane and has been linked to tumorigenesis and the progression of pituitary adenomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Mouse(75689) HIG1 domain family, member 1B
Rat(287738) HIG1 hypoxia inducible domain family, member 1B
dog(480496) HIG1 hypoxia inducible domain family, member 1B
cow(510275) HIG1 hypoxia inducible domain family, member 1B
domestic cat(101080752) HIG1 hypoxia inducible domain family, member 1B
domestic guinea pig(100726269) HIG1 hypoxia inducible domain family, member 1B
sheep(101116490) HIG1 hypoxia inducible domain family, member 1B
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080846 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080846 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080846 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016438 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016438 Rosetta Predictions human pricing
NM_001105844 Rosetta Predictions rat pricing
XM_213488 Rosetta Predictions rat pricing
NM_080846 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349468 predicted 315
2 SASI_Hs01_00030832 predicted 263
3 SASI_Hs01_00030834 predicted 383
4 SASI_Hs01_00030835 predicted 323
5 SASI_Hs01_00030836 predicted 259
6 SASI_Hs01_00030837 predicted 272
7 SASI_Hs01_00030838 predicted 367
8 SASI_Hs01_00030839 predicted 277
9 SASI_Hs01_00030840 predicted 311
10 SASI_Hs01_00030841 predicted 390
11 SASI_Hs01_00030833 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105844 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213082 predicted 474
2 SASI_Rn02_00213083 predicted 477
3 SASI_Rn02_00213084 predicted 412
4 SASI_Rn02_00213085 predicted 405
5 SASI_Rn02_00213086 predicted 411
6 SASI_Rn02_00213087 predicted 416
7 SASI_Rn02_00213088 predicted 440
8 SASI_Rn02_00213089 predicted 487
9 SASI_Rn02_00213090 predicted 388
10 SASI_Rn02_00213091 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213488 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00140546 predicted 338
2 SASI_Rn01_00140547 predicted 341
3 SASI_Rn01_00140548 predicted 264
4 SASI_Rn01_00140549 predicted 269
5 SASI_Rn01_00140550 predicted 273
6 SASI_Rn01_00140551 predicted 294
7 SASI_Rn01_00140552 predicted 345
8 SASI_Rn01_00140553 predicted 259
9 SASI_Rn01_00140554 predicted 331
10 SASI_Rn01_00140555 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127989 predicted 482
2 SASI_Mm01_00127990 predicted 439
3 SASI_Mm01_00127991 predicted 481
4 SASI_Mm01_00127992 predicted 400
5 SASI_Mm01_00127994 predicted 414
6 SASI_Mm01_00127995 predicted 405
7 SASI_Mm01_00127996 predicted 441
8 SASI_Mm01_00127997 predicted 385
9 SASI_Mm01_00127998 predicted 489
10 SASI_Mm02_00338219 predicted 388
11 SASI_Mm01_00127993 predicted 478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080846
HIGD1B MISSION shRNA Bacterial Glycerol Stock
HIG1 hypoxia inducible domain family, member 1B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080846.1-497s21c1
Sequence:CCGGTACAGGATTTACCGGCTGAAGCTCGAGCTTCAGCCGGTAAATCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080846.1-447s21c1
Sequence:CCGGAGTCTCCACTGGTGCCTATAGCTCGAGCTATAGGCACCAGTGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080846.1-415s21c1
Sequence:CCGGCCTGTCCAAGAAGTTCCTAAGCTCGAGCTTAGGAACTTCTTGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080846.1-538s21c1
Sequence:CCGGCTCCATCCATCTGATTCACACCTCGAGGTGTGAATCAGATGGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080846.1-486s21c1
Sequence:CCGGTGATAGCAGCATACAGGATTTCTCGAGAAATCCTGTATGCTGCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080846
HIGD1B MISSION shRNA shRNA Plasmid DNA
HIG1 hypoxia inducible domain family, member 1B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080846.1-497s21c1
Sequence:CCGGTACAGGATTTACCGGCTGAAGCTCGAGCTTCAGCCGGTAAATCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080846.1-447s21c1
Sequence:CCGGAGTCTCCACTGGTGCCTATAGCTCGAGCTATAGGCACCAGTGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080846.1-415s21c1
Sequence:CCGGCCTGTCCAAGAAGTTCCTAAGCTCGAGCTTAGGAACTTCTTGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080846.1-538s21c1
Sequence:CCGGCTCCATCCATCTGATTCACACCTCGAGGTGTGAATCAGATGGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080846.1-486s21c1
Sequence:CCGGTGATAGCAGCATACAGGATTTCTCGAGAAATCCTGTATGCTGCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080846
HIGD1B MISSION shRNA Lentiviral Transduction Particles
HIG1 hypoxia inducible domain family, member 1B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080846.1-497s21c1
Sequence:CCGGTACAGGATTTACCGGCTGAAGCTCGAGCTTCAGCCGGTAAATCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080846.1-447s21c1
Sequence:CCGGAGTCTCCACTGGTGCCTATAGCTCGAGCTATAGGCACCAGTGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080846.1-415s21c1
Sequence:CCGGCCTGTCCAAGAAGTTCCTAAGCTCGAGCTTAGGAACTTCTTGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080846.1-538s21c1
Sequence:CCGGCTCCATCCATCTGATTCACACCTCGAGGTGTGAATCAGATGGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080846.1-486s21c1
Sequence:CCGGTGATAGCAGCATACAGGATTTCTCGAGAAATCCTGTATGCTGCTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016438
HIGD1B MISSION shRNA Bacterial Glycerol Stock
HIG1 hypoxia inducible domain family, member 1B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-281s1c1
Sequence:CCGGCGAAGACTGTGTGTCTGAGAACTCGAGTTCTCAGACACACAGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-501s1c1
Sequence:CCGGGATTACGTCAAGAGGATGGCACTCGAGTGCCATCCTCTTGACGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-321s1c1
Sequence:CCGGGAATCTCCACTGGTGCCTATACTCGAGTATAGGCACCAGTGGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-282s1c1
Sequence:CCGGGAAGACTGTGTGTCTGAGAAGCTCGAGCTTCTCAGACACACAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-363s1c1
Sequence:CCGGGTAGCAGCATACAGGATTTACCTCGAGGTAAATCCTGTATGCTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-488s1c1
Sequence:CCGGCACAATGTACAGCGATTACGTCTCGAGACGTAATCGCTGTACATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-407s1c1
Sequence:CCGGCAAGATGTCCATACACCTGATCTCGAGATCAGGTGTATGGACATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-473s1c1
Sequence:CCGGGCTAGGTGCTGTGTACACAATCTCGAGATTGTGTACACAGCACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-466s1c1
Sequence:CCGGCAATCATGCTAGGTGCTGTGTCTCGAGACACAGCACCTAGCATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-370s1c1
Sequence:CCGGCATACAGGATTTACCGGCTGACTCGAGTCAGCCGGTAAATCCTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016438
HIGD1B MISSION shRNA shRNA Plasmid DNA
HIG1 hypoxia inducible domain family, member 1B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-281s1c1
Sequence:CCGGCGAAGACTGTGTGTCTGAGAACTCGAGTTCTCAGACACACAGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-501s1c1
Sequence:CCGGGATTACGTCAAGAGGATGGCACTCGAGTGCCATCCTCTTGACGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-321s1c1
Sequence:CCGGGAATCTCCACTGGTGCCTATACTCGAGTATAGGCACCAGTGGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-282s1c1
Sequence:CCGGGAAGACTGTGTGTCTGAGAAGCTCGAGCTTCTCAGACACACAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-363s1c1
Sequence:CCGGGTAGCAGCATACAGGATTTACCTCGAGGTAAATCCTGTATGCTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-488s1c1
Sequence:CCGGCACAATGTACAGCGATTACGTCTCGAGACGTAATCGCTGTACATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-407s1c1
Sequence:CCGGCAAGATGTCCATACACCTGATCTCGAGATCAGGTGTATGGACATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-473s1c1
Sequence:CCGGGCTAGGTGCTGTGTACACAATCTCGAGATTGTGTACACAGCACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-466s1c1
Sequence:CCGGCAATCATGCTAGGTGCTGTGTCTCGAGACACAGCACCTAGCATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-370s1c1
Sequence:CCGGCATACAGGATTTACCGGCTGACTCGAGTCAGCCGGTAAATCCTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016438
HIGD1B MISSION shRNA Lentiviral Transduction Particles
HIG1 hypoxia inducible domain family, member 1B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-281s1c1
Sequence:CCGGCGAAGACTGTGTGTCTGAGAACTCGAGTTCTCAGACACACAGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-501s1c1
Sequence:CCGGGATTACGTCAAGAGGATGGCACTCGAGTGCCATCCTCTTGACGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-321s1c1
Sequence:CCGGGAATCTCCACTGGTGCCTATACTCGAGTATAGGCACCAGTGGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-282s1c1
Sequence:CCGGGAAGACTGTGTGTCTGAGAAGCTCGAGCTTCTCAGACACACAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-363s1c1
Sequence:CCGGGTAGCAGCATACAGGATTTACCTCGAGGTAAATCCTGTATGCTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-488s1c1
Sequence:CCGGCACAATGTACAGCGATTACGTCTCGAGACGTAATCGCTGTACATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-407s1c1
Sequence:CCGGCAAGATGTCCATACACCTGATCTCGAGATCAGGTGTATGGACATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-473s1c1
Sequence:CCGGGCTAGGTGCTGTGTACACAATCTCGAGATTGTGTACACAGCACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-466s1c1
Sequence:CCGGCAATCATGCTAGGTGCTGTGTCTCGAGACACAGCACCTAGCATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016438.2-370s1c1
Sequence:CCGGCATACAGGATTTACCGGCTGACTCGAGTCAGCCGGTAAATCCTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks