EMAIL THIS PAGE TO A FRIEND

HINT2

histidine triad nucleotide binding protein 2

Synonyms: HIT-17
UniProtKB ID: Q9BX68, Q5TCW3
Gene ID:
Human(84681) Summary: Histidine triad proteins, such as HINT2, are nucleotide hydrolases and transferases that act on the alpha-phosphate of ribonucleotides (Brenner, 2002 [PubMed 12119013]
Mouse(68917) histidine triad nucleotide binding protein 2
Rat(313491) histidine triad nucleotide binding protein 2
Zebrafish(798688) histidine triad nucleotide binding protein 2
dog(481599) histidine triad nucleotide binding protein 2
domestic cat(101094547) histidine triad nucleotide binding protein 2
cow(281816) histidine triad nucleotide binding protein 2
domestic guinea pig(100732298) histidine triad nucleotide binding protein 2
naked mole-rat(101713589) histidine triad nucleotide binding protein 2
sheep(101112539) histidine triad nucleotide binding protein 2
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_143732 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_143732 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_143732 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032593 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032593 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032593 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026871 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026871 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026871 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU203651 MISSION® esiRNA esiRNA targeting mouse Hint2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032593 Rosetta Predictions human pricing
NM_001107955 Rosetta Predictions rat pricing
NM_026871 Rosetta Predictions mouse pricing
XM_143732 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245960 predicted 281
2 SASI_Hs01_00245961 predicted 385
3 SASI_Hs01_00245962 predicted 327
4 SASI_Hs01_00245963 predicted 320
5 SASI_Hs01_00245964 predicted 227
6 SASI_Hs01_00245965 predicted 349
7 SASI_Hs01_00245966 predicted 319
8 SASI_Hs01_00245967 predicted 383
9 SASI_Hs02_00360132 predicted 223
10 SASI_Hs01_00245968 predicted 334
11 SASI_Hs01_00245969 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107955 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233935 predicted 212
2 SASI_Rn02_00233936 predicted 259
3 SASI_Rn02_00233937 predicted 357
4 SASI_Rn02_00233938 predicted 250
5 SASI_Rn02_00233939 predicted 315
6 SASI_Rn02_00233940 predicted 224
7 SASI_Rn02_00233941 predicted 217
8 SASI_Rn02_00233942 predicted 314
9 SASI_Rn02_00233943 predicted 255
10 SASI_Rn02_00233944 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026871 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331102 predicted 324
2 SASI_Mm02_00331103 predicted 224
3 SASI_Mm02_00331104 predicted 227
4 SASI_Mm02_00331105 predicted 267
5 SASI_Mm02_00331106 predicted 287
6 SASI_Mm02_00331107 predicted 244
7 SASI_Mm02_00331108 predicted 198
8 SASI_Mm02_00331109 predicted 203
9 SASI_Mm02_00331110 predicted 306
10 SASI_Mm02_00331111 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_143732 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228867 predicted 242
2 SASI_Mm01_00228868 predicted 232
3 SASI_Mm01_00228869 predicted 273
4 SASI_Mm01_00228870 predicted 299
5 SASI_Mm01_00228871 predicted 264
6 SASI_Mm01_00228872 predicted 213
7 SASI_Mm01_00228873 predicted 265
8 SASI_Mm01_00228874 predicted 209
9 SASI_Mm01_00228875 predicted 315
10 SASI_Mm01_00228876 predicted 349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_143732
VALIDATED
HINT2 MISSION shRNA Bacterial Glycerol Stock
histidine triad nucleotide binding protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_143732.3-274s1c1
Sequence:CCGGGCTGACATTCTATATGAAGATCTCGAGATCTTCATATAGAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_143732.3-370s1c1
Sequence:CCGGCCTCGAATTAGCCAGGCTGAACTCGAGTTCAGCCTGGCTAATTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_143732.3-474s1c1
Sequence:CCGGACTTGTGGTTAATGATGGCAACTCGAGTTGCCATCATTAACCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_143732.3-235s1c1
Sequence:CCGGCCAACCATCTTCTCCCGGATTCTCGAGAATCCGGGAGAAGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143732.3-402s1c1
Sequence:CCGGGCAGCTTCTAGGACACTTACTCTCGAGAGTAAGTGTCCTAGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_143732
VALIDATED
HINT2 MISSION shRNA shRNA Plasmid DNA
histidine triad nucleotide binding protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_143732.3-274s1c1
Sequence:CCGGGCTGACATTCTATATGAAGATCTCGAGATCTTCATATAGAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_143732.3-370s1c1
Sequence:CCGGCCTCGAATTAGCCAGGCTGAACTCGAGTTCAGCCTGGCTAATTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_143732.3-474s1c1
Sequence:CCGGACTTGTGGTTAATGATGGCAACTCGAGTTGCCATCATTAACCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_143732.3-235s1c1
Sequence:CCGGCCAACCATCTTCTCCCGGATTCTCGAGAATCCGGGAGAAGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143732.3-402s1c1
Sequence:CCGGGCAGCTTCTAGGACACTTACTCTCGAGAGTAAGTGTCCTAGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_143732
VALIDATED
HINT2 MISSION shRNA Lentiviral Transduction Particles
histidine triad nucleotide binding protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_143732.3-274s1c1
Sequence:CCGGGCTGACATTCTATATGAAGATCTCGAGATCTTCATATAGAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_143732.3-370s1c1
Sequence:CCGGCCTCGAATTAGCCAGGCTGAACTCGAGTTCAGCCTGGCTAATTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_143732.3-474s1c1
Sequence:CCGGACTTGTGGTTAATGATGGCAACTCGAGTTGCCATCATTAACCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_143732.3-235s1c1
Sequence:CCGGCCAACCATCTTCTCCCGGATTCTCGAGAATCCGGGAGAAGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143732.3-402s1c1
Sequence:CCGGGCAGCTTCTAGGACACTTACTCTCGAGAGTAAGTGTCCTAGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032593
VALIDATED
HINT2 MISSION shRNA Bacterial Glycerol Stock
histidine triad nucleotide binding protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_032593.1-250s1c1
Sequence:CCGGCAGTGTCTTGTGTTCCGTGATCTCGAGATCACGGAACACAAGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_032593.1-124s1c1
Sequence:CCGGGCAGGTGTGACTGATGGGAATCTCGAGATTCCCATCAGTCACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032593.1-448s1c1
Sequence:CCGGCTGGGTGCACAATCTGTGTATCTCGAGATACACAGATTGTGCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032593.1-414s1c1
Sequence:CCGGAGATGGATACCGACTTGTGATCTCGAGATCACAAGTCGGTATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032593.1-311s1c1
Sequence:CCGGAGAAGCCCATTCCTCGGATTACTCGAGTAATCCGAGGAATGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032593.2-484s21c1
Sequence:CCGGCTGGGTGCACAATCTGTGTATCTCGAGATACACAGATTGTGCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032593.2-160s21c1
Sequence:CCGGGCAGGTGTGACTGATGGGAATCTCGAGATTCCCATCAGTCACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032593.2-450s21c1
Sequence:CCGGAGATGGATACCGACTTGTGATCTCGAGATCACAAGTCGGTATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032593.2-286s21c1
Sequence:CCGGCAGTGTCTTGTGTTCCGTGATCTCGAGATCACGGAACACAAGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032593
VALIDATED
HINT2 MISSION shRNA shRNA Plasmid DNA
histidine triad nucleotide binding protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_032593.1-250s1c1
Sequence:CCGGCAGTGTCTTGTGTTCCGTGATCTCGAGATCACGGAACACAAGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_032593.1-124s1c1
Sequence:CCGGGCAGGTGTGACTGATGGGAATCTCGAGATTCCCATCAGTCACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032593.1-448s1c1
Sequence:CCGGCTGGGTGCACAATCTGTGTATCTCGAGATACACAGATTGTGCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032593.1-414s1c1
Sequence:CCGGAGATGGATACCGACTTGTGATCTCGAGATCACAAGTCGGTATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032593.1-311s1c1
Sequence:CCGGAGAAGCCCATTCCTCGGATTACTCGAGTAATCCGAGGAATGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032593.2-484s21c1
Sequence:CCGGCTGGGTGCACAATCTGTGTATCTCGAGATACACAGATTGTGCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032593.2-160s21c1
Sequence:CCGGGCAGGTGTGACTGATGGGAATCTCGAGATTCCCATCAGTCACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032593.2-450s21c1
Sequence:CCGGAGATGGATACCGACTTGTGATCTCGAGATCACAAGTCGGTATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032593.2-286s21c1
Sequence:CCGGCAGTGTCTTGTGTTCCGTGATCTCGAGATCACGGAACACAAGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032593
VALIDATED
HINT2 MISSION shRNA Lentiviral Transduction Particles
histidine triad nucleotide binding protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_032593.1-250s1c1
Sequence:CCGGCAGTGTCTTGTGTTCCGTGATCTCGAGATCACGGAACACAAGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_032593.1-124s1c1
Sequence:CCGGGCAGGTGTGACTGATGGGAATCTCGAGATTCCCATCAGTCACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032593.1-448s1c1
Sequence:CCGGCTGGGTGCACAATCTGTGTATCTCGAGATACACAGATTGTGCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032593.1-414s1c1
Sequence:CCGGAGATGGATACCGACTTGTGATCTCGAGATCACAAGTCGGTATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032593.1-311s1c1
Sequence:CCGGAGAAGCCCATTCCTCGGATTACTCGAGTAATCCGAGGAATGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032593.2-484s21c1
Sequence:CCGGCTGGGTGCACAATCTGTGTATCTCGAGATACACAGATTGTGCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032593.2-160s21c1
Sequence:CCGGGCAGGTGTGACTGATGGGAATCTCGAGATTCCCATCAGTCACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032593.2-450s21c1
Sequence:CCGGAGATGGATACCGACTTGTGATCTCGAGATCACAAGTCGGTATCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032593.2-286s21c1
Sequence:CCGGCAGTGTCTTGTGTTCCGTGATCTCGAGATCACGGAACACAAGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026871
HINT2 MISSION shRNA Bacterial Glycerol Stock
histidine triad nucleotide binding protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026871.1-298s21c1
Sequence:CCGGCCTCGAATTAGCCAGGCTGAACTCGAGTTCAGCCTGGCTAATTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026871.1-202s21c1
Sequence:CCGGGCTGACATTCTATATGAAGATCTCGAGATCTTCATATAGAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026871.1-330s21c1
Sequence:CCGGGCAGCTTCTAGGACACTTACTCTCGAGAGTAAGTGTCCTAGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026871.1-163s21c1
Sequence:CCGGCCAACCATCTTCTCCCGGATTCTCGAGAATCCGGGAGAAGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026871.1-402s21c1
Sequence:CCGGACTTGTGGTTAATGATGGCAACTCGAGTTGCCATCATTAACCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026871
HINT2 MISSION shRNA shRNA Plasmid DNA
histidine triad nucleotide binding protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026871.1-298s21c1
Sequence:CCGGCCTCGAATTAGCCAGGCTGAACTCGAGTTCAGCCTGGCTAATTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026871.1-202s21c1
Sequence:CCGGGCTGACATTCTATATGAAGATCTCGAGATCTTCATATAGAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026871.1-330s21c1
Sequence:CCGGGCAGCTTCTAGGACACTTACTCTCGAGAGTAAGTGTCCTAGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026871.1-163s21c1
Sequence:CCGGCCAACCATCTTCTCCCGGATTCTCGAGAATCCGGGAGAAGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026871.1-402s21c1
Sequence:CCGGACTTGTGGTTAATGATGGCAACTCGAGTTGCCATCATTAACCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026871
HINT2 MISSION shRNA Lentiviral Transduction Particles
histidine triad nucleotide binding protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026871.1-298s21c1
Sequence:CCGGCCTCGAATTAGCCAGGCTGAACTCGAGTTCAGCCTGGCTAATTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026871.1-202s21c1
Sequence:CCGGGCTGACATTCTATATGAAGATCTCGAGATCTTCATATAGAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026871.1-330s21c1
Sequence:CCGGGCAGCTTCTAGGACACTTACTCTCGAGAGTAAGTGTCCTAGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026871.1-163s21c1
Sequence:CCGGCCAACCATCTTCTCCCGGATTCTCGAGAATCCGGGAGAAGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026871.1-402s21c1
Sequence:CCGGACTTGTGGTTAATGATGGCAACTCGAGTTGCCATCATTAACCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks