EMAIL THIS PAGE TO A FRIEND

HIST1H2BA

histone cluster 1, H2ba

Synonyms: H2BFU STBP TSH2B bA317E16.3
UniProtKB ID: Q96A08, B2R544, Q6NZ98, Q6NZA0, Q6NZA1
Gene ID:
Human(255626) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a testis/sperm-specific member of the histone H2B family. Transcripts from this gene contain a palindromic termination element. [provided by RefSeq, Jul 2008]
Mouse(319177) histone cluster 1, H2ba
Rat(24829) histone cluster 1, H2ba
cow(618216) histone cluster 1, H2ba
dog(488252) histone cluster 1, H2ba
cow(100335534) histone cluster 1, H2ba
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175663 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175663 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175663 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_170610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170610 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_170610 Rosetta Predictions human pricing
NM_022643 Rosetta Predictions rat pricing
NM_175663 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185338 predicted 195
2 SASI_Hs01_00185339 predicted 202
3 SASI_Hs01_00185340 predicted 196
4 SASI_Hs01_00185344 predicted 15
5 SASI_Hs01_00185345 predicted 288
6 SASI_Hs01_00185346 predicted 376
7 SASI_Hs01_00185347 predicted 380
8 SASI_Hs01_00185342 predicted 376
9 SASI_Hs02_00367564 predicted 261
10 SASI_Hs02_00367565 predicted 228
11 SASI_Hs01_00185341 predicted 115
12 SASI_Hs01_00185343 predicted 163
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061876 predicted 231
2 SASI_Rn01_00061877 predicted 231
3 SASI_Rn01_00061878 predicted 237
4 SASI_Rn01_00061879 predicted 146
5 SASI_Rn02_00263427 predicted 429
6 SASI_Rn01_00061881 predicted 145
7 SASI_Rn02_00263428 predicted 69
8 SASI_Rn01_00061882 predicted 135
9 SASI_Rn01_00061883 predicted 70
10 SASI_Rn01_00061884 predicted 156
11 SASI_Rn01_00061880 predicted 430
12 SASI_Rn01_00061885 predicted 61
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194238 predicted 22
2 SASI_Mm01_00194239 predicted 5
3 SASI_Mm01_00194241 predicted 104
4 SASI_Mm01_00194242 predicted 10
5 SASI_Mm01_00194243 predicted 103
6 SASI_Mm01_00194244 predicted 103
7 SASI_Mm01_00194245 predicted 104
8 SASI_Mm01_00194246 predicted 9
9 SASI_Mm01_00194247 predicted 13
10 SASI_Mm02_00346601 predicted 19
11 SASI_Mm01_00194240 predicted 197
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175663
HIST1H2BA MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2ba
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175663.1-113s1c1
Sequence:CCGGGCTACTCCATTTACATCTATACTCGAGTATAGATGTAAATGGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175663.1-192s1c1
Sequence:CCGGGAACTCCTTTGTGACAGACATCTCGAGATGTCTGTCACAAAGGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175663.1-204s1c1
Sequence:CCGGGACAGACATCTTCGAGCGCATCTCGAGATGCGCTCGAAGATGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175663.1-45s1c1
Sequence:CCGGCTTCAAGAAAGCGGTCACCAACTCGAGTTGGTGACCGCTTTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175663.1-87s1c1
Sequence:CCGGGAAACGTAAGAGATGCCGCAACTCGAGTTGCGGCATCTCTTACGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175663
HIST1H2BA MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2ba
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175663.1-113s1c1
Sequence:CCGGGCTACTCCATTTACATCTATACTCGAGTATAGATGTAAATGGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175663.1-192s1c1
Sequence:CCGGGAACTCCTTTGTGACAGACATCTCGAGATGTCTGTCACAAAGGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175663.1-204s1c1
Sequence:CCGGGACAGACATCTTCGAGCGCATCTCGAGATGCGCTCGAAGATGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175663.1-45s1c1
Sequence:CCGGCTTCAAGAAAGCGGTCACCAACTCGAGTTGGTGACCGCTTTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175663.1-87s1c1
Sequence:CCGGGAAACGTAAGAGATGCCGCAACTCGAGTTGCGGCATCTCTTACGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175663
HIST1H2BA MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2ba
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175663.1-113s1c1
Sequence:CCGGGCTACTCCATTTACATCTATACTCGAGTATAGATGTAAATGGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175663.1-192s1c1
Sequence:CCGGGAACTCCTTTGTGACAGACATCTCGAGATGTCTGTCACAAAGGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175663.1-204s1c1
Sequence:CCGGGACAGACATCTTCGAGCGCATCTCGAGATGCGCTCGAAGATGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175663.1-45s1c1
Sequence:CCGGCTTCAAGAAAGCGGTCACCAACTCGAGTTGGTGACCGCTTTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175663.1-87s1c1
Sequence:CCGGGAAACGTAAGAGATGCCGCAACTCGAGTTGCGGCATCTCTTACGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170610
HIST1H2BA MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2ba
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170610.2-55s1c1
Sequence:CCGGGCTGTCGTTAAGACCCAGAAACTCGAGTTTCTGGGTCTTAACGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170610.2-268s1c1
Sequence:CCGGACCATTTCTTCCAGAGAGATTCTCGAGAATCTCTCTGGAAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170610.2-174s1c1
Sequence:CCGGGAAAGCTATGAGCATTATGAACTCGAGTTCATAATGCTCATAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170610.2-204s1c1
Sequence:CCGGCACTGATATCTTTGAGCGTATCTCGAGATACGCTCAAAGATATCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170610.2-266s1c1
Sequence:CCGGCCACCATTTCTTCCAGAGAGACTCGAGTCTCTCTGGAAGAAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170610.2-316s21c1
Sequence:CCGGGGAGAGCTGGCTAAACATGCTCTCGAGAGCATGTTTAGCCAGCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170610.2-98s21c1
Sequence:CCGGGGACCCGTAAGGAGAGTTATTCTCGAGAATAACTCTCCTTACGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170610.2-123s21c1
Sequence:CCGGTTACATCTACAAAGTGCTAAACTCGAGTTTAGCACTTTGTAGATGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170610
HIST1H2BA MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2ba
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170610.2-55s1c1
Sequence:CCGGGCTGTCGTTAAGACCCAGAAACTCGAGTTTCTGGGTCTTAACGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170610.2-268s1c1
Sequence:CCGGACCATTTCTTCCAGAGAGATTCTCGAGAATCTCTCTGGAAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170610.2-174s1c1
Sequence:CCGGGAAAGCTATGAGCATTATGAACTCGAGTTCATAATGCTCATAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170610.2-204s1c1
Sequence:CCGGCACTGATATCTTTGAGCGTATCTCGAGATACGCTCAAAGATATCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170610.2-266s1c1
Sequence:CCGGCCACCATTTCTTCCAGAGAGACTCGAGTCTCTCTGGAAGAAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170610.2-316s21c1
Sequence:CCGGGGAGAGCTGGCTAAACATGCTCTCGAGAGCATGTTTAGCCAGCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170610.2-98s21c1
Sequence:CCGGGGACCCGTAAGGAGAGTTATTCTCGAGAATAACTCTCCTTACGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170610.2-123s21c1
Sequence:CCGGTTACATCTACAAAGTGCTAAACTCGAGTTTAGCACTTTGTAGATGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170610
HIST1H2BA MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2ba
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170610.2-55s1c1
Sequence:CCGGGCTGTCGTTAAGACCCAGAAACTCGAGTTTCTGGGTCTTAACGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170610.2-268s1c1
Sequence:CCGGACCATTTCTTCCAGAGAGATTCTCGAGAATCTCTCTGGAAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170610.2-174s1c1
Sequence:CCGGGAAAGCTATGAGCATTATGAACTCGAGTTCATAATGCTCATAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170610.2-204s1c1
Sequence:CCGGCACTGATATCTTTGAGCGTATCTCGAGATACGCTCAAAGATATCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170610.2-266s1c1
Sequence:CCGGCCACCATTTCTTCCAGAGAGACTCGAGTCTCTCTGGAAGAAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170610.2-316s21c1
Sequence:CCGGGGAGAGCTGGCTAAACATGCTCTCGAGAGCATGTTTAGCCAGCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170610.2-98s21c1
Sequence:CCGGGGACCCGTAAGGAGAGTTATTCTCGAGAATAACTCTCCTTACGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170610.2-123s21c1
Sequence:CCGGTTACATCTACAAAGTGCTAAACTCGAGTTTAGCACTTTGTAGATGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks