EMAIL THIS PAGE TO A FRIEND

HIST1H2BF

histone cluster 1, H2bf

Synonyms: H2B/g H2BFG
Gene ID:
Human(8343) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(319180) histone cluster 1, H2bf
Rat(306969) histone cluster 1, H2bf
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178195 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178195 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178195 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003522 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003522 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003522 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148481 MISSION® esiRNA esiRNA human HIST1H2BF (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003522 Rosetta Predictions human pricing
XM_001061682 Rosetta Predictions rat pricing
XM_225384 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192769 predicted 369
2 SASI_Hs01_00192770 predicted 378
3 SASI_Hs01_00192771 predicted 385
4 SASI_Hs01_00192772 predicted 77
5 SASI_Hs01_00192774 predicted 363
6 SASI_Hs01_00192775 predicted 314
7 SASI_Hs01_00192773 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061682 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300968 predicted 392
2 SASI_Rn02_00300969 predicted 411
3 SASI_Rn02_00300970 predicted 421
4 SASI_Rn02_00300971 predicted 400
5 SASI_Rn02_00300972 predicted 396
6 SASI_Rn02_00300973 predicted 408
7 SASI_Rn02_00300974 predicted 388
8 SASI_Rn02_00300975 predicted 311
9 SASI_Rn02_00300976 predicted 441
10 SASI_Rn02_00300977 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225384 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382806 predicted 385
2 SASI_Rn02_00382807 predicted 404
3 SASI_Rn02_00382808 predicted 408
4 SASI_Rn02_00382809 predicted 390
5 SASI_Rn02_00382810 predicted 386
6 SASI_Rn02_00382811 predicted 391
7 SASI_Rn02_00382812 predicted 380
8 SASI_Rn02_00382813 predicted 429
9 SASI_Rn02_00382814 predicted 387
10 SASI_Rn02_00382815 predicted 430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178195
HIST1H2BF MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bf
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178195.1-192s1c1
Sequence:CCGGCTCGTTTGTGAACGACATCTTCTCGAGAAGATGTCGTTCACAAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178195.1-182s1c1
Sequence:CCGGGCATCATGAACTCGTTTGTGACTCGAGTCACAAACGAGTTCATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178195.1-178s1c1
Sequence:CCGGATGGGCATCATGAACTCGTTTCTCGAGAAACGAGTTCATGATGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178195.1-189s1c1
Sequence:CCGGGAACTCGTTTGTGAACGACATCTCGAGATGTCGTTCACAAACGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178195.1-183s1c1
Sequence:CCGGCATCATGAACTCGTTTGTGAACTCGAGTTCACAAACGAGTTCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178195
HIST1H2BF MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bf
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178195.1-192s1c1
Sequence:CCGGCTCGTTTGTGAACGACATCTTCTCGAGAAGATGTCGTTCACAAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178195.1-182s1c1
Sequence:CCGGGCATCATGAACTCGTTTGTGACTCGAGTCACAAACGAGTTCATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178195.1-178s1c1
Sequence:CCGGATGGGCATCATGAACTCGTTTCTCGAGAAACGAGTTCATGATGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178195.1-189s1c1
Sequence:CCGGGAACTCGTTTGTGAACGACATCTCGAGATGTCGTTCACAAACGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178195.1-183s1c1
Sequence:CCGGCATCATGAACTCGTTTGTGAACTCGAGTTCACAAACGAGTTCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178195
HIST1H2BF MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bf
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178195.1-192s1c1
Sequence:CCGGCTCGTTTGTGAACGACATCTTCTCGAGAAGATGTCGTTCACAAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178195.1-182s1c1
Sequence:CCGGGCATCATGAACTCGTTTGTGACTCGAGTCACAAACGAGTTCATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178195.1-178s1c1
Sequence:CCGGATGGGCATCATGAACTCGTTTCTCGAGAAACGAGTTCATGATGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178195.1-189s1c1
Sequence:CCGGGAACTCGTTTGTGAACGACATCTCGAGATGTCGTTCACAAACGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178195.1-183s1c1
Sequence:CCGGCATCATGAACTCGTTTGTGAACTCGAGTTCACAAACGAGTTCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003522
VALIDATED
HIST1H2BF MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bf
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003522.3-72s1c1
Sequence:CCGGGAAGGATGGTAAGAAGCGCAACTCGAGTTGCGCTTCTTACCATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003522.3-177s1c1
Sequence:CCGGCATGGGCATCATGAACTCCTTCTCGAGAAGGAGTTCATGATGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003522.3-264s1c1
Sequence:CCGGCACCATCACCTCCAGGGAGATCTCGAGATCTCCCTGGAGGTGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003522.3-94s1c1
Sequence:CCGGCGTAGCCGCAAGGAGAGCTATCTCGAGATAGCTCTCCTTGCGGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003522.3-66s1c1
Sequence:CCGGGCAGAAGAAGGATGGTAAGAACTCGAGTTCTTACCATCCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003522.3-189s21c1
Sequence:CCGGGAACTCCTTCGTCAACGATATCTCGAGATATCGTTGACGAAGGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003522.3-250s21c1
Sequence:CCGGTACAACAAGCGCTCCACCATCCTCGAGGATGGTGGAGCGCTTGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_003522.3-108s21c1
Sequence:CCGGGAGCTATTCCGTGTACGTGTACTCGAGTACACGTACACGGAATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_003522.3-120s21c1
Sequence:CCGGGTACGTGTACAAGGTGCTAAACTCGAGTTTAGCACCTTGTACACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003522.3-203s21c1
Sequence:CCGGACGATATCTTCGAGCGCATCGCTCGAGCGATGCGCTCGAAGATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003522
VALIDATED
HIST1H2BF MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bf
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003522.3-72s1c1
Sequence:CCGGGAAGGATGGTAAGAAGCGCAACTCGAGTTGCGCTTCTTACCATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003522.3-177s1c1
Sequence:CCGGCATGGGCATCATGAACTCCTTCTCGAGAAGGAGTTCATGATGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003522.3-264s1c1
Sequence:CCGGCACCATCACCTCCAGGGAGATCTCGAGATCTCCCTGGAGGTGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003522.3-94s1c1
Sequence:CCGGCGTAGCCGCAAGGAGAGCTATCTCGAGATAGCTCTCCTTGCGGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003522.3-66s1c1
Sequence:CCGGGCAGAAGAAGGATGGTAAGAACTCGAGTTCTTACCATCCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003522.3-189s21c1
Sequence:CCGGGAACTCCTTCGTCAACGATATCTCGAGATATCGTTGACGAAGGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003522.3-250s21c1
Sequence:CCGGTACAACAAGCGCTCCACCATCCTCGAGGATGGTGGAGCGCTTGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_003522.3-108s21c1
Sequence:CCGGGAGCTATTCCGTGTACGTGTACTCGAGTACACGTACACGGAATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_003522.3-120s21c1
Sequence:CCGGGTACGTGTACAAGGTGCTAAACTCGAGTTTAGCACCTTGTACACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003522.3-203s21c1
Sequence:CCGGACGATATCTTCGAGCGCATCGCTCGAGCGATGCGCTCGAAGATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003522
VALIDATED
HIST1H2BF MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bf
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003522.3-72s1c1
Sequence:CCGGGAAGGATGGTAAGAAGCGCAACTCGAGTTGCGCTTCTTACCATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003522.3-177s1c1
Sequence:CCGGCATGGGCATCATGAACTCCTTCTCGAGAAGGAGTTCATGATGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003522.3-264s1c1
Sequence:CCGGCACCATCACCTCCAGGGAGATCTCGAGATCTCCCTGGAGGTGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003522.3-94s1c1
Sequence:CCGGCGTAGCCGCAAGGAGAGCTATCTCGAGATAGCTCTCCTTGCGGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003522.3-66s1c1
Sequence:CCGGGCAGAAGAAGGATGGTAAGAACTCGAGTTCTTACCATCCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003522.3-189s21c1
Sequence:CCGGGAACTCCTTCGTCAACGATATCTCGAGATATCGTTGACGAAGGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003522.3-250s21c1
Sequence:CCGGTACAACAAGCGCTCCACCATCCTCGAGGATGGTGGAGCGCTTGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_003522.3-108s21c1
Sequence:CCGGGAGCTATTCCGTGTACGTGTACTCGAGTACACGTACACGGAATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_003522.3-120s21c1
Sequence:CCGGGTACGTGTACAAGGTGCTAAACTCGAGTTTAGCACCTTGTACACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003522.3-203s21c1
Sequence:CCGGACGATATCTTCGAGCGCATCGCTCGAGCGATGCGCTCGAAGATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks