EMAIL THIS PAGE TO A FRIEND

HIST1H2BJ

histone cluster 1, H2bj

Synonyms: H2B/r H2BFR H2BJ
UniProtKB ID: P06899, B2R4J4, O60816
Gene ID:
Human(8970) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the histone microcluster on chromosome 6p21.33. [provided by RefSeq, Jul 2008]
Mouse(319183) histone cluster 1, H2bj
Rat(306964) histone cluster 1, H2bj
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021058 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021058 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021058 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112421 MISSION® esiRNA esiRNA human HIST1H2BJ (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021058 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138494 predicted 230
2 SASI_Hs01_00138495 predicted 223
3 SASI_Hs01_00138496 predicted 227
4 SASI_Hs01_00138497 predicted 235
5 SASI_Hs01_00138498 predicted 225
6 SASI_Hs01_00138499 predicted 234
7 SASI_Hs01_00138500 predicted 222
8 SASI_Hs01_00138501 predicted 427
9 SASI_Hs01_00138502 predicted 192
10 SASI_Hs01_00138503 predicted 438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021058
HIST1H2BJ MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bj
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021058.3-237s1c1
Sequence:CCGGATTCGTTTGTGAACGACATTTCTCGAGAAATGTCGTTCACAAACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021058.3-112s1c1
Sequence:CCGGGCAGAAGAAAGACGGCAAGAACTCGAGTTCTTGCCGTCTTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021058.3-154s1c1
Sequence:CCGGGAGCTATTCCATCTATGTGTACTCGAGTACACATAGATGGAATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021058.3-229s1c1
Sequence:CCGGCATCATGAATTCGTTTGTGAACTCGAGTTCACAAACGAATTCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021058.3-205s1c1
Sequence:CCGGCGGCATTTCGTCCAAGGCCATCTCGAGATGGCCTTGGACGAAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021058
HIST1H2BJ MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bj
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021058.3-237s1c1
Sequence:CCGGATTCGTTTGTGAACGACATTTCTCGAGAAATGTCGTTCACAAACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021058.3-112s1c1
Sequence:CCGGGCAGAAGAAAGACGGCAAGAACTCGAGTTCTTGCCGTCTTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021058.3-154s1c1
Sequence:CCGGGAGCTATTCCATCTATGTGTACTCGAGTACACATAGATGGAATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021058.3-229s1c1
Sequence:CCGGCATCATGAATTCGTTTGTGAACTCGAGTTCACAAACGAATTCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021058.3-205s1c1
Sequence:CCGGCGGCATTTCGTCCAAGGCCATCTCGAGATGGCCTTGGACGAAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021058
HIST1H2BJ MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bj
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021058.3-237s1c1
Sequence:CCGGATTCGTTTGTGAACGACATTTCTCGAGAAATGTCGTTCACAAACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021058.3-112s1c1
Sequence:CCGGGCAGAAGAAAGACGGCAAGAACTCGAGTTCTTGCCGTCTTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021058.3-154s1c1
Sequence:CCGGGAGCTATTCCATCTATGTGTACTCGAGTACACATAGATGGAATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021058.3-229s1c1
Sequence:CCGGCATCATGAATTCGTTTGTGAACTCGAGTTCACAAACGAATTCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021058.3-205s1c1
Sequence:CCGGCGGCATTTCGTCCAAGGCCATCTCGAGATGGCCTTGGACGAAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178198
HIST1H2BJ MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bj
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178198.1-120s1c1
Sequence:CCGGGTACGTCTACAAGGTGCTGAACTCGAGTTCAGCACCTTGTAGACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178198.1-159s1c1
Sequence:CCGGCGGTATCTCCTCCAAGGCCATCTCGAGATGGCCTTGGAGGAGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178198.1-124s1c1
Sequence:CCGGGTCTACAAGGTGCTGAAGCAACTCGAGTTGCTTCAGCACCTTGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178198.1-153s1c1
Sequence:CCGGCGACACCGGTATCTCCTCCAACTCGAGTTGGAGGAGATACCGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178198.1-111s1c1
Sequence:CCGGCTACTCGGTGTACGTCTACAACTCGAGTTGTAGACGTACACCGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178198
HIST1H2BJ MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bj
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178198.1-120s1c1
Sequence:CCGGGTACGTCTACAAGGTGCTGAACTCGAGTTCAGCACCTTGTAGACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178198.1-159s1c1
Sequence:CCGGCGGTATCTCCTCCAAGGCCATCTCGAGATGGCCTTGGAGGAGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178198.1-124s1c1
Sequence:CCGGGTCTACAAGGTGCTGAAGCAACTCGAGTTGCTTCAGCACCTTGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178198.1-153s1c1
Sequence:CCGGCGACACCGGTATCTCCTCCAACTCGAGTTGGAGGAGATACCGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178198.1-111s1c1
Sequence:CCGGCTACTCGGTGTACGTCTACAACTCGAGTTGTAGACGTACACCGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178198
HIST1H2BJ MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bj
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178198.1-120s1c1
Sequence:CCGGGTACGTCTACAAGGTGCTGAACTCGAGTTCAGCACCTTGTAGACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178198.1-159s1c1
Sequence:CCGGCGGTATCTCCTCCAAGGCCATCTCGAGATGGCCTTGGAGGAGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178198.1-124s1c1
Sequence:CCGGGTCTACAAGGTGCTGAAGCAACTCGAGTTGCTTCAGCACCTTGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178198.1-153s1c1
Sequence:CCGGCGACACCGGTATCTCCTCCAACTCGAGTTGGAGGAGATACCGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178198.1-111s1c1
Sequence:CCGGCTACTCGGTGTACGTCTACAACTCGAGTTGTAGACGTACACCGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks