EMAIL THIS PAGE TO A FRIEND

HIST1H2BL

histone cluster 1, H2bl

Synonyms: H2B/c H2BFC dJ97D16.4
UniProtKB ID: Q99880, B2R5A3, Q52LW9
Gene ID:
Human(8340) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Mouse(319185) histone cluster 1, H2bl
Rat(64647) histone cluster 1, H2bl
cow(506306) histone cluster 1, H2bl
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302661 ANTI-HIST1H2BL (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003519 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003519 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003519 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178199 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178199 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178199 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003519 Rosetta Predictions human pricing
NM_022647 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107040 predicted 398
2 SASI_Hs01_00107041 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042662 predicted 143
2 SASI_Rn01_00042663 predicted 146
3 SASI_Rn01_00042664 predicted 49
4 SASI_Rn01_00042665 predicted 51
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003519
HIST1H2BL MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bl
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003519.3-147s21c1
Sequence:CCGCACGTGTACAAGGTGCTGAAGCCTCGAGGCTTCAGCACCTTGTACACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003519.3-210s21c1
Sequence:CCGGTCATGAACTCCTTCGTCAACGCTCGAGCGTTGACGAAGGAGTTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003519.3-184s1c1
Sequence:CCGGCGGCATCTCTTCTAAGGCCATCTCGAGATGGCCTTAGAAGAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003519.3-226s1c1
Sequence:CCGGCAACGACATCTTCGAGCGCATCTCGAGATGCGCTCGAAGATGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003519.3-190s1c1
Sequence:CCGGCTCTTCTAAGGCCATGGGAATCTCGAGATTCCCATGGCCTTAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003519.3-136s1c1
Sequence:CCGGCTACTCCGTGTACGTGTACAACTCGAGTTGTACACGTACACGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003519.3-289s1c1
Sequence:CCGGGACCATCACCTCCAGGGAGATCTCGAGATCTCCCTGGAGGTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003519
HIST1H2BL MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bl
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003519.3-147s21c1
Sequence:CCGCACGTGTACAAGGTGCTGAAGCCTCGAGGCTTCAGCACCTTGTACACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003519.3-210s21c1
Sequence:CCGGTCATGAACTCCTTCGTCAACGCTCGAGCGTTGACGAAGGAGTTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003519.3-184s1c1
Sequence:CCGGCGGCATCTCTTCTAAGGCCATCTCGAGATGGCCTTAGAAGAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003519.3-226s1c1
Sequence:CCGGCAACGACATCTTCGAGCGCATCTCGAGATGCGCTCGAAGATGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003519.3-190s1c1
Sequence:CCGGCTCTTCTAAGGCCATGGGAATCTCGAGATTCCCATGGCCTTAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003519.3-136s1c1
Sequence:CCGGCTACTCCGTGTACGTGTACAACTCGAGTTGTACACGTACACGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003519.3-289s1c1
Sequence:CCGGGACCATCACCTCCAGGGAGATCTCGAGATCTCCCTGGAGGTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003519
HIST1H2BL MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bl
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003519.3-147s21c1
Sequence:CCGCACGTGTACAAGGTGCTGAAGCCTCGAGGCTTCAGCACCTTGTACACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003519.3-210s21c1
Sequence:CCGGTCATGAACTCCTTCGTCAACGCTCGAGCGTTGACGAAGGAGTTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003519.3-184s1c1
Sequence:CCGGCGGCATCTCTTCTAAGGCCATCTCGAGATGGCCTTAGAAGAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003519.3-226s1c1
Sequence:CCGGCAACGACATCTTCGAGCGCATCTCGAGATGCGCTCGAAGATGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003519.3-190s1c1
Sequence:CCGGCTCTTCTAAGGCCATGGGAATCTCGAGATTCCCATGGCCTTAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003519.3-136s1c1
Sequence:CCGGCTACTCCGTGTACGTGTACAACTCGAGTTGTACACGTACACGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003519.3-289s1c1
Sequence:CCGGGACCATCACCTCCAGGGAGATCTCGAGATCTCCCTGGAGGTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178199
HIST1H2BL MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bl
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178199.1-182s1c1
Sequence:CCGGGCATCATGAACTCGTTCGTGACTCGAGTCACGAACGAGTTCATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178199.1-41s1c1
Sequence:CCGGGCTCCAAGAAGGCCGTCACCACTCGAGTGGTGACGGCCTTCTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178199.1-195s1c1
Sequence:CCGGGTTCGTGAACGACATCTTCGACTCGAGTCGAAGATGTCGTTCACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178199.1-153s1c1
Sequence:CCGGCGACACCGGCATCTCCTCCAACTCGAGTTGGAGGAGATGCCGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178199.1-72s1c1
Sequence:CCGGGAAGGACGGCAAGAAGCGCAACTCGAGTTGCGCTTCTTGCCGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178199
HIST1H2BL MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bl
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178199.1-182s1c1
Sequence:CCGGGCATCATGAACTCGTTCGTGACTCGAGTCACGAACGAGTTCATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178199.1-41s1c1
Sequence:CCGGGCTCCAAGAAGGCCGTCACCACTCGAGTGGTGACGGCCTTCTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178199.1-195s1c1
Sequence:CCGGGTTCGTGAACGACATCTTCGACTCGAGTCGAAGATGTCGTTCACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178199.1-153s1c1
Sequence:CCGGCGACACCGGCATCTCCTCCAACTCGAGTTGGAGGAGATGCCGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178199.1-72s1c1
Sequence:CCGGGAAGGACGGCAAGAAGCGCAACTCGAGTTGCGCTTCTTGCCGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178199
HIST1H2BL MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bl
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178199.1-182s1c1
Sequence:CCGGGCATCATGAACTCGTTCGTGACTCGAGTCACGAACGAGTTCATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178199.1-41s1c1
Sequence:CCGGGCTCCAAGAAGGCCGTCACCACTCGAGTGGTGACGGCCTTCTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178199.1-195s1c1
Sequence:CCGGGTTCGTGAACGACATCTTCGACTCGAGTCGAAGATGTCGTTCACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178199.1-153s1c1
Sequence:CCGGCGACACCGGCATCTCCTCCAACTCGAGTTGGAGGAGATGCCGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178199.1-72s1c1
Sequence:CCGGGAAGGACGGCAAGAAGCGCAACTCGAGTTGCGCTTCTTGCCGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks