EMAIL THIS PAGE TO A FRIEND

HIST1H2BM

histone cluster 1, H2bm

Synonyms: H2B/e H2BFE dJ160A22.3
UniProtKB ID: Q99879, Q6NWQ3
Gene ID:
Human(8342) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Mouse(319186) histone cluster 1, H2bm
cow(529646) histone cluster 1, H2bm
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178200 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178200 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178200 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003521 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003521 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003521 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112351 MISSION® esiRNA esiRNA human HIST1H2BM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003521 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059556 predicted 207
2 SASI_Hs01_00059557 predicted 207
3 SASI_Hs01_00059558 predicted 38
4 SASI_Hs01_00059559 predicted 37
5 SASI_Hs01_00059560 predicted 45
6 SASI_Hs01_00059561 predicted 7
7 SASI_Hs01_00059562 predicted 49
8 SASI_Hs01_00059563 predicted 33
9 SASI_Hs01_00059564 predicted 160
10 SASI_Hs01_00059565 predicted 51
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178200
HIST1H2BM MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bm
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178200.1-66s1c1
Sequence:CCGGCCAGAAGAAGGATGGCAAGAACTCGAGTTCTTGCCATCCTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178200.1-129s1c1
Sequence:CCGGCAAGGTGCTAAAGCAAGTGCACTCGAGTGCACTTGCTTTAGCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178200.1-124s1c1
Sequence:CCGGGTGTACAAGGTGCTAAAGCAACTCGAGTTGCTTTAGCACCTTGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178200.1-189s1c1
Sequence:CCGGGAACTCGTTCGTGAACGACATCTCGAGATGTCGTTCACGAACGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178200.1-120s1c1
Sequence:CCGGGTACGTGTACAAGGTGCTAAACTCGAGTTTAGCACCTTGTACACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178200
HIST1H2BM MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bm
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178200.1-66s1c1
Sequence:CCGGCCAGAAGAAGGATGGCAAGAACTCGAGTTCTTGCCATCCTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178200.1-129s1c1
Sequence:CCGGCAAGGTGCTAAAGCAAGTGCACTCGAGTGCACTTGCTTTAGCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178200.1-124s1c1
Sequence:CCGGGTGTACAAGGTGCTAAAGCAACTCGAGTTGCTTTAGCACCTTGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178200.1-189s1c1
Sequence:CCGGGAACTCGTTCGTGAACGACATCTCGAGATGTCGTTCACGAACGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178200.1-120s1c1
Sequence:CCGGGTACGTGTACAAGGTGCTAAACTCGAGTTTAGCACCTTGTACACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178200
HIST1H2BM MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bm
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178200.1-66s1c1
Sequence:CCGGCCAGAAGAAGGATGGCAAGAACTCGAGTTCTTGCCATCCTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178200.1-129s1c1
Sequence:CCGGCAAGGTGCTAAAGCAAGTGCACTCGAGTGCACTTGCTTTAGCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178200.1-124s1c1
Sequence:CCGGGTGTACAAGGTGCTAAAGCAACTCGAGTTGCTTTAGCACCTTGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178200.1-189s1c1
Sequence:CCGGGAACTCGTTCGTGAACGACATCTCGAGATGTCGTTCACGAACGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178200.1-120s1c1
Sequence:CCGGGTACGTGTACAAGGTGCTAAACTCGAGTTTAGCACCTTGTACACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003521
HIST1H2BM MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bm
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003521.2-42s1c1
Sequence:CCGGCTCCAAGAAGGCCATTAACAACTCGAGTTGTTAATGGCCTTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003521.2-210s1c1
Sequence:CCGGCTTTGAGCGTATCGCCGGAGACTCGAGTCTCCGGCGATACGCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003521.2-48s1c1
Sequence:CCGGGAAGGCCATTAACAAGGCTCACTCGAGTGAGCCTTGTTAATGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003521.2-54s1c1
Sequence:CCGGCATTAACAAGGCTCAGAAGAACTCGAGTTCTTCTGAGCCTTGTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003521.2-159s1c1
Sequence:CCGGCGGCATCTCTTCCAAGGCTATCTCGAGATAGCCTTGGAAGAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003521.2-78s21c1
Sequence:CCGGTGGAAAGAAGCGCAAACGCAGCTCGAGCTGCGTTTGCGCTTCTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003521.2-184s21c1
Sequence:CCGGATCATGAACTCCTTCGTCAACCTCGAGGTTGACGAAGGAGTTCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003521.2-348s21c1
Sequence:CCGGCAAGGCCGTCACCAAGTATACCTCGAGGTATACTTGGTGACGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003521
HIST1H2BM MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bm
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003521.2-42s1c1
Sequence:CCGGCTCCAAGAAGGCCATTAACAACTCGAGTTGTTAATGGCCTTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003521.2-210s1c1
Sequence:CCGGCTTTGAGCGTATCGCCGGAGACTCGAGTCTCCGGCGATACGCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003521.2-48s1c1
Sequence:CCGGGAAGGCCATTAACAAGGCTCACTCGAGTGAGCCTTGTTAATGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003521.2-54s1c1
Sequence:CCGGCATTAACAAGGCTCAGAAGAACTCGAGTTCTTCTGAGCCTTGTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003521.2-159s1c1
Sequence:CCGGCGGCATCTCTTCCAAGGCTATCTCGAGATAGCCTTGGAAGAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003521.2-78s21c1
Sequence:CCGGTGGAAAGAAGCGCAAACGCAGCTCGAGCTGCGTTTGCGCTTCTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003521.2-184s21c1
Sequence:CCGGATCATGAACTCCTTCGTCAACCTCGAGGTTGACGAAGGAGTTCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003521.2-348s21c1
Sequence:CCGGCAAGGCCGTCACCAAGTATACCTCGAGGTATACTTGGTGACGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003521
HIST1H2BM MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bm
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003521.2-42s1c1
Sequence:CCGGCTCCAAGAAGGCCATTAACAACTCGAGTTGTTAATGGCCTTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003521.2-210s1c1
Sequence:CCGGCTTTGAGCGTATCGCCGGAGACTCGAGTCTCCGGCGATACGCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003521.2-48s1c1
Sequence:CCGGGAAGGCCATTAACAAGGCTCACTCGAGTGAGCCTTGTTAATGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003521.2-54s1c1
Sequence:CCGGCATTAACAAGGCTCAGAAGAACTCGAGTTCTTCTGAGCCTTGTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003521.2-159s1c1
Sequence:CCGGCGGCATCTCTTCCAAGGCTATCTCGAGATAGCCTTGGAAGAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003521.2-78s21c1
Sequence:CCGGTGGAAAGAAGCGCAAACGCAGCTCGAGCTGCGTTTGCGCTTCTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003521.2-184s21c1
Sequence:CCGGATCATGAACTCCTTCGTCAACCTCGAGGTTGACGAAGGAGTTCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003521.2-348s21c1
Sequence:CCGGCAAGGCCGTCACCAAGTATACCTCGAGGTATACTTGGTGACGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks