EMAIL THIS PAGE TO A FRIEND

HIST1H2BO

histone cluster 1, H2bo

Synonyms: H2B.2 H2B/n H2BFN dJ193B12.2
UniProtKB ID: P23527, Q3KPI7, Q8TCV6
Gene ID:
Human(8348) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Rat(291157) histone cluster 1, H2bo
29 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302659 ANTI-HIST1H2BO/HIST1H2BH (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003527 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003527 Rosetta Predictions human pricing
NM_001106114 Rosetta Predictions rat pricing
XM_214483 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070074 predicted 84
2 SASI_Hs01_00070075 predicted 87
3 SASI_Hs01_00070077 predicted 425
4 SASI_Hs01_00070080 predicted 143
5 SASI_Hs01_00070076 predicted 83
6 SASI_Hs01_00070078 predicted 147
7 SASI_Hs01_00070079 predicted 137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106114 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215762 predicted 442
2 SASI_Rn02_00215763 predicted 374
3 SASI_Rn02_00215764 predicted 374
4 SASI_Rn02_00215765 predicted 377
5 SASI_Rn02_00215766 predicted 439
6 SASI_Rn02_00215767 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214483 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00167280 predicted 232
2 SASI_Rn01_00167281 predicted 236
3 SASI_Rn01_00167282 predicted 228
4 SASI_Rn01_00167283 predicted 232
5 SASI_Rn01_00167284 predicted 235
6 SASI_Rn01_00167285 predicted 236
7 SASI_Rn01_00167286 predicted 228
8 SASI_Rn01_00167287 predicted 230
9 SASI_Rn01_00167288 predicted 236
10 SASI_Rn01_00167289 predicted 372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003527
HIST1H2BO MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bo
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003527.4-239s1c1
Sequence:CCGGCAATGACATCTTTGAGCGCATCTCGAGATGCGCTCAAAGATGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003527.4-90s1c1
Sequence:CCGGGCCGTAACCAAGGCCCAGAAACTCGAGTTTCTGGGCCTTGGTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003527.4-146s1c1
Sequence:CCGGGAGTTACTCTATCTACGTGTACTCGAGTACACGTAGATAGAGTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003527.4-137s1c1
Sequence:CCGGCCGCAAAGAGAGTTACTCTATCTCGAGATAGAGTAACTCTCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003527.4-197s1c1
Sequence:CCGGCGGCATCTCATCGAAGGCCATCTCGAGATGGCCTTCGATGAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003527.4-209s21c1
Sequence:CCGGGAAGGCCATGGGCATCATGAACTCGAGTTCATGATGCCCATGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003527.4-79s21c1
Sequence:CCGGGCTCCAAGAAAGCCGTAACCACTCGAGTGGTTACGGCTTTCTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003527
HIST1H2BO MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bo
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003527.4-239s1c1
Sequence:CCGGCAATGACATCTTTGAGCGCATCTCGAGATGCGCTCAAAGATGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003527.4-90s1c1
Sequence:CCGGGCCGTAACCAAGGCCCAGAAACTCGAGTTTCTGGGCCTTGGTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003527.4-146s1c1
Sequence:CCGGGAGTTACTCTATCTACGTGTACTCGAGTACACGTAGATAGAGTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003527.4-137s1c1
Sequence:CCGGCCGCAAAGAGAGTTACTCTATCTCGAGATAGAGTAACTCTCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003527.4-197s1c1
Sequence:CCGGCGGCATCTCATCGAAGGCCATCTCGAGATGGCCTTCGATGAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003527.4-209s21c1
Sequence:CCGGGAAGGCCATGGGCATCATGAACTCGAGTTCATGATGCCCATGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003527.4-79s21c1
Sequence:CCGGGCTCCAAGAAAGCCGTAACCACTCGAGTGGTTACGGCTTTCTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003527
HIST1H2BO MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bo
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003527.4-239s1c1
Sequence:CCGGCAATGACATCTTTGAGCGCATCTCGAGATGCGCTCAAAGATGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003527.4-90s1c1
Sequence:CCGGGCCGTAACCAAGGCCCAGAAACTCGAGTTTCTGGGCCTTGGTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003527.4-146s1c1
Sequence:CCGGGAGTTACTCTATCTACGTGTACTCGAGTACACGTAGATAGAGTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003527.4-137s1c1
Sequence:CCGGCCGCAAAGAGAGTTACTCTATCTCGAGATAGAGTAACTCTCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003527.4-197s1c1
Sequence:CCGGCGGCATCTCATCGAAGGCCATCTCGAGATGGCCTTCGATGAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003527.4-209s21c1
Sequence:CCGGGAAGGCCATGGGCATCATGAACTCGAGTTCATGATGCCCATGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003527.4-79s21c1
Sequence:CCGGGCTCCAAGAAAGCCGTAACCACTCGAGTGGTTACGGCTTTCTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks