EMAIL THIS PAGE TO A FRIEND

HIST1H3H

histone cluster 1, H3h

Synonyms: H3/k H3F1K H3FK
Gene ID:
Human(8357) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Mouse(319152) histone cluster 1, H3h
Rat(680511) histone cluster 1, H3h
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H9161 Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution bovine, frog, human, mouse, Drosophila, Caenorhabditis elegans, rat, chicken
immunofluorescence, microarray, western blot pricing
H9286 Anti-acetyl-Histone H3 (Ac-Lys9) antibody produced in rabbit 2-2.5 mg/mL, affinity isolated antibody, buffered aqueous solution Drosophila, human, bovine, chicken, frog, Caenorhabditis elegans, rat, mouse
immunofluorescence, microarray, western blot pricing
H0913 Anti-acetyl-Histone H3 (Ac-Lys9) antibody, Mouse monoclonal clone AH3-120, purified from hybridoma cell culture human, mouse, bovine, chicken, frog, rat, Drosophila, Caenorhabditis elegans
ELISA, immunocytochemistry, microarray, western blot pricing
D5692 Anti-dimethyl-Histone H3 (diMe-Lys4) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Caenorhabditis elegans, Arabidopsis thaliana, human, Drosophila, bovine, frog, rat, chicken, mouse
ChIP, microarray, western blot pricing
D5567 Anti-dimethyl-Histone H3 (diMe-Lys9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Arabidopsis thaliana, Drosophila, Caenorhabditis elegans, human, bovine, chicken, frog, rat, mouse
ChIP, microarray, western blot pricing
H0164 Anti-Histone H3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, plant, human, rat, Drosophila, chicken, Xenopus
immunofluorescence, western blot pricing
M4819 Anti-methyl-Histone H3 (Me-Lys4) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, Caenorhabditis elegans, mouse, bovine, Drosophila, human, frog, Arabidopsis thaliana, rat
western blot pricing
H7162 Anti-methyl-Histone H3 (Me-Lys9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, Caenorhabditis elegans, rat, bovine, chicken, frog, human, Drosophila
microarray, western blot pricing
H0412 Anti-phospho-Histone H3 (pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse, frog, Drosophila, rat, Caenorhabditis elegans, bovine, chicken
immunofluorescence, microarray, western blot pricing
SAB4503877 Anti-phospho-Histone H3 (pSer28) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4503876 Anti-phospho-Histone H3 (pThr3) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504429 Anti-phospho-Histone H3.1 (pSer10) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB5100007 Imprint®ChIP-Validated Anti-Acetyl-Histone H3 (Ac-Lys9) (H3K9ac) antibody produced in rabbit affinity isolated antibody human
ChIP, western blot pricing
SAB5100009 Imprint ® ChiP-Validated Anti-methyl-Histone H3 (Me-Lys4) (H3K4me1) antibody produced in rabbit affinity isolated antibody chicken, frog, mouse, bovine, human
ChIP, western blot pricing
SAB5100008 Imprint® ChIP-Validated Anti-methyl-Histone H3 (Me-Lys9) (H3K9me1) affinity isolated antibody human
ChIP, western blot pricing
H0788 Monoclonal Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in mouse ~2 mg/mL, clone APH3-64, purified immunoglobulin, buffered aqueous solution frog, rat, Drosophila, Caenorhabditis elegans, human, mouse, bovine, chicken
ELISA, immunoprecipitation, microarray, western blot pricing
H9908 Monoclonal Anti-phospho-Histone H3 (pSer28) antibody produced in rat ~0.5 mg/mL, clone HTA28, purified immunoglobulin, buffered aqueous solution human, bovine, hamster, mouse
flow cytometry, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178206 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178206 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178206 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003536 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003536 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003536 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
ABE1057 Anti-acetyl Histone H3 Antibody (Lys 64) 100 µL, Anti-acetyl Histone H3 Antibody is an antibody against acetyl Histone H3 for use in Western Blotting, Immunocytochemistry, Dot Blot. pricing
ABE1029 Anti-acetyl Histone H3 Antibody (Lys122) 100 µg, Anti-acetyl Histone H3 (Lys122) is an antibody against acetyl Histone H3 (Lys122) for use in WB, ICC, DB, IP. pricing
07-360 Anti-acetyl-Histone H3 (Lys27) Antibody 100 µL, Anti-acetyl-Histone H3 (Lys27) Antibody is a rabbit polyclonal antibody for detection of Histone H3 acetylated on lysine 27. Also known as Anti-H3K27ac this antibody is published in peer reviewed journals and is specificity verified by dot blot (DB) and validated in ChIP, ChIP-seq, WB, DB, Mplex. pricing
ABE1362 Anti-acetyl Histone H3(Lys27) Antibody 50 µg, This Anti-acetyl Histone H3(Lys27) Antibody is validated for use in Western Blotting and Immunocytochemistry and Chromatin Immunoprecipitation (ChIP) and ChIP-seq and Dot Blot and ELISA for the detection of acetyl Histone H3(Lys27). pricing
07-360-S Anti-acetyl-Histone H3 (Lys27) Antibody, Trial Size 10 µL, Anti-acetyl-Histone H3 (Lys27) Antibody is a Rabbit Polyclonal Antibody for detection of Histone H3 acetylated at lysine 27 (H3K27ac). This antibody has dot blot verified specificity and has been validated in ChIP, WB & Mplex. pricing
ABE223 Anti-acetyl Histone H3 (Lys4) Antibody 100 µL, Use Anti-acetyl Histone H3 (Lys4) Antibody (Rabbit Polyclonal Antibody) validated in WB, IP, DB to detect acetyl Histone H3 (Lys4) also known as Histone H3.1. pricing
07-539-AF488 Anti-acetyl-Histone H3 (Lys4) Antibody, Alexa Fluor® 488 conjugate 100 µL, Anti-acetyl-Histone H3 (Lys4) Antibody, Alexa Fluor® 488 conjugate is an antibody against histone Lys4 acetylation for use in Immunocytochemistry. pricing
ABE223-S Anti-acetyl Histone H3 (Lys4) Antibody, Trial Size 10 µL, Use Anti-acetyl Histone H3 (Lys4) Antibody (Rabbit Polyclonal Antibody), Trial Size / Pack validated in WB, IP, DB to detect acetyl Histone H3 (Lys4) also known as Histone H3.1. pricing
07-677-I Anti-acetyl-Histone H3 (Lys56) Antibody 200 µL, Anti-acetyl-Histone H3 (Lys56) is an antibody targeting the acetyl-Histone H3 (Lys56) protein, validated for use in WB & ChIP. pricing
07-677-IS Anti-acetyl-Histone H3 (Lys56) Antibody, Trial Size 20 µL, Anti-acetyl-Histone H3 (Lys56) Antibody, Trial Size/ Pack is a rabbit polyclonal antibody for detection of acetyl-Histone H3 (Lys56) also known as H3K56Ac, Histone H3 (acetyl K56) & has been validated in WB, ChIP. pricing
06-942 Anti-acetyl-Histone H3 (Lys9) Antibody 200 µg, Anti-acetyl-Histone H3 (Lys9) Antibody is a Rabbit Polyclonal Antibody for detection of Histone H3 acetylated on lysine 9. This purified Ab, also known as Anti-H3K9Ac, is specificity verified by dot blot (DB), published in peer reviewed journals, and validated in WB, ChIP, ChIP-seq, FC. pricing
ABE18 Anti-acetyl Histone H3 (Lys9) Antibody 100 µg, Anti-acetyl Histone H3 (Lys9) Antibody is a rabbit polyclonal antibody for detection of Histone H3 acetylated at lysine 9. This purified antibody, also known as Anti-H4K9ac has dot blot (DB) proven specificity and has been validated in WB, DB, ChIP, Mplex. pricing
06-942-AF555 Anti-acetyl-Histone H3 (Lys9) Antibody, Alexa Fluor® 555 Conjugate 100 µL, Anti-acetyl-Histone H3 (Lys9) Antibody, Alexa Fluor® 555 Conjugate, Cat. No. 06-942-AF555, is a highly specific rabbit polyclonal antibody that targets histone H3 Lys9 acetylation (H3K9ac) and has been tested in Flow Cytometry and Immunocytochemistry. pricing
06-942-AF647 Anti-acetyl-Histone H3 (Lys9) Antibody, Alexa Fluor® 647 Conjugate 100 µL, Anti-acetyl-Histone H3 (Lys9), Alexa Fluor® 647 Conjugate Antibody, Cat. No. 06-942-AF647, is a highly specific rabbit polyclonal antibody that targets histone H3 Lys9 acetylation (H3K9ac) and has been tested in Flow Cytometry and Immunocytochemistry. pricing
06-942-S Anti-acetyl-Histone H3 (Lys9) Antibody, Trial Size 20 µg, Anti-acetyl-Histone H3 (Lys9) Antibody, Trial Size is a Rabbit Polyclonal Antibody for detection of Histone H3 acetylated on lysine 9 (H3K9ac). This purified Ab is specificity verified by dot blot (DB) and validated in WB, ChIP, ChIP-seq, FC. Small pack size is ideal for screening applications. pricing
ABE18-S Anti-acetyl Histone H3 (Lys9) Antibody, Trial Size 10 µg, Anti-acetyl Histone H3 (Lys9) Antibody, Trial Size is a rabbit polyclonal for detection of Histone H3 acetylated at lysine 9. Also known as Anti-H3K9ac, this antibody has dot blot (DB) proven specificity and has been validated in WB, ChIP, Mplex. Small pack size is ideal for screening applications pricing
ABE375 Anti-acetyl-phospho Histone H1.4/H3 (Lys26/Lys9, Ser27/Ser10) Antibody 100 µg, This Anti-acetyl-phospho Histone H1.4/H3 (Lys26/Lys9, Ser27/Ser10) Antibody is validated for use in Dot Blot, IP for the detection of acetyl-phospho Histone H1.4/H3 (Lys26/Lys9, Ser27/Ser10). pricing
MABE246 Anti-dimethyl Histone H3 Antibody (Arg17), symmetric 100 µg, Detect Histone H3 using this mouse monoclonal antibody, Anti-dimethyl Histone H3 Antibody (Arg17), symmetric validated for use in western blotting, Dot Blot & ICC. pricing
07-030-AF647 Anti-dimethyl Histone H3 Antibody (Lys4), Alexa Fluor® 647 Conjugate 100 µL, This Anti-dimethyl Histone H3 Antibody (Lys4), Alexa Fluor® 647 Conjugate is validated for use in Immunocytochemistry for the detection of dimethyl Histone H3. pricing
ABE324 Anti-dimethyl Histone H3 (Arg17) Antibody 100 µg, Detect Histone H3 using this rabbit polyclonal antibody, Anti-dimethyl Histone H3 (Arg17) Antibody validated for use in western blotting, Dot Blot & ICC. pricing
ABE328 Anti-dimethyl Histone H3 (Arg2) Antibody 200 µL, Detect Histone H3 using this rabbit polyclonal antibody, Anti-dimethyl Histone H3 (Arg2) Antibody validated for use in western blotting & Dot Blot. pricing
ABE377 Anti-dimethyl Histone H3 (Arg2) asymmetric Antibody 100 µL, Anti-dimethyl Histone H3 (Arg2) asymmetric is an antibody against dimethyl Histone H3 (Arg2) asymmetric for use in WB, ICC, Dot Blot. pricing
ABE460 Anti-dimethyl Histone H3 (Arg2), symmetric Antibody 100 µL, This Anti-dimethyl Histone H3 (Arg2) antibody, symmetric is validated for use in western blotting, dot blot, IHC & ChIP for the detection of dimethyl Histone H3 (Arg2). pricing
ABE411 Anti-dimethyl Histone H3 (Arg26), Asymmetric Antibody 100 µg, This Anti-dimethyl Histone H3 (Arg26) antibody, Asymmetric is validated for use in western blotting, ICC & dot blot for the detection of dimethyl Histone H3 (Arg26). pricing
ABE411-S Anti-dimethyl Histone H3 (Arg26), Asymmetric, Trial Size Antibody 10 µg, This Anti-dimethyl Histone H3 (Arg26) antibody, Asymmetric, Trial Size is validated for use in western blotting, ICC & dot blot for the detection of dimethyl Histone H3 (Arg26). pricing
07-421-I Anti-dimethyl Histone H3 (Lys27) 100 µL, Anti-dimethyl Histone H3 (Lys27) Antibody, Cat. No. 07-421-I, is a highly specific chicken polyclonal antibody that targets histone H3 Lys27 dimethylation (H3K27me2) and has been tested in Dot Blot, Chromatin Immunoprecipitation, and Western Blotting. pricing
ABE250 Anti-dimethyl Histone H3 (Lys4) Antibody 100 µL, Anti-dimethyl Histone H3 (Lys4) Antibody is a Rabbit Polyclonal Antibody for detection of Histone H3 dimethylated at lysine 4. This purified polyclonal antibody, also known as H3K4me2, has dot blot (DB) proven specificity & has been validated in WB, ICC, ChIP. pricing
07-030-AF488 Anti-dimethyl-Histone H3 (Lys4) Antibody, Alexa Fluor® 488 conjugate 100 µL, Anti-dimethyl-Histone H3 (Lys4) Antibody, Alexa Fluor® 488 conjugate is an antibody against histone Lys4 dimethylation for use in Immunocytochemistry. pricing
07-030-AF555 Anti-dimethyl Histone H3 (Lys4) Antibody, Alexa Fluor® 555 Conjugate 100 µL, This Anti-dimethyl Histone H3 (Lys4) Antibody, Alexa Fluor® 555 Conjugate is validated for use in Immunocytochemistry for the detection of dimethyl Histone H3. pricing
ABE250-S Anti-dimethyl Histone H3 (Lys4) Antibody, Trial Size 10 µL, Anti-dimethyl Histone H3 (Lys4) Antibody, Trial Size is a Rabbit Polyclonal for detection of Histone H3 dimethylated at lysine 4. Also known as H3K4me2, this Ab has dot blot (DB) proven specificity & has been validated in WB, ICC, ChIP. Small pack size is ideal for screening applications. pricing
ABE459 Anti-dimethyl Histone H3 (Lys79) Antibody 100 µL, Detect Histone H3 using this rabbit polyclonal antibody, Anti-dimethyl Histone H3 (Lys79) Antibody validated for use in western blotting, Dot Blot & ELISA. pricing
MABE241 Anti-dimethyl-phospho Histone H3 (Lys9/27)/(Ser10/28) Antibody, clone 51TA-2H12 100 µL, Anti-dimethyl-phospho Histone H3 (Lys9/27)/(Ser10/28) Antibody, clone 51TA-2H12 is a Mouse Monoclonal Antibody for detection of dimethyl-phospho Histone H3 (Lys9/27)/(Ser10/28) also known as Histone H3.1 & has been validated in WB, DB, ICC, IP & IHC. pricing
MABE952 Anti-Histone H3.1 Antibody, clone 1D4F2 100 µg, This Anti-Histone H3.1 Antibody, clone 1D4F2 is validated for use in western blotting, ICC, IP, ChIP & ChIP-seq for the detection of Histone H3.1. pricing
ABE154 Anti-Histone H3.1/H3.2 Antibody 100 µg, Anti-Histone H3.1/H3.2 Antibody is a highly specific rabbit polyclonal antibody, that targets Histone H3 & has been tested in western blotting & ChIP-seq. pricing
ABE1447 Anti-Histone H3 Antibody, K36M mutant 200 µL, Anti-Histone H3, K36M mutant, Cat. No. ABE1447, is a highly specific rabbit polyclonal antibody that targets Histone H3 K36M mutation (H3K36M) and has been tested in Dot Blot, Immunohistochemistry, and Western Blotting. pricing
05-791R Anti-mono/di/trimethyl-Histone H3 (Lys4) Antibody, clone AW304, rabbit monoclonal 100 µL, Anti-mono/di/trimethyl-Histone H3 (Lys4) Antibody, clone AW304 is a rabbit monoclonal antibody for detection of mono/di/trimethyl-Histone H3 (Lys4) also known as histone H3.1, H3 histone family member I & has been validated in WB, PIA. pricing
ABE14 Anti-monomethyl Histone H3 Antibody (Arg26) 100 µg, Detect Histone H3 using this rabbit polyclonal antibody, Anti-monomethyl Histone H3 Antibody (Arg26) validated for use in western blotting, Dot Blot & ICC. pricing
ABE244 Anti-monomethyl-Histone H3 Antibody (Lys36) 100 µg, Anti-monomethyl-Histone H3 (Lys36) Antibody is a rabbit polyclonal antibody for detection of Histone H3 monomethylated at lysine 36. This purified polyclonal antibody also known as Anti-H3K36me1, has dot blot (DB) proven specificity & has been validated in WB, IP. pricing
07-448 Anti-monomethyl-Histone H3 (Lys27) Antibody 200 µg, Anti-monomethyl-Histone H3 (Lys27) Antibody is a rabbit polyclonal antibody to detect Histone H3 monomethylated at lysine 27. This purified Ab, also known as Anti-H3K27me1 is specificity verified by dot blot (DB), published in peer reviewed journals and validated in ICC, WB, ChIP, ChIP-seq. pricing
07-448-S Anti-monomethyl-Histone H3 (Lys27) Antibody, Trial Size 20 µg, Anti-monomethyl-Histone H3 (Lys27), Trial Size Antibody is a Rabbit Polyclonal Antibody for detection of Histone H3 monomethylated on lysine 27 (H3K27me1). This antibody has dot blot (DB) verified specificity and is validated in, ICC, WB, ChIP, ChIP-seq. Small pack size is ideal for screening. pricing
ABE244-S Anti-monomethyl-Histone H3 (Lys36) Antibody, Trial Size 10 µg, Anti-monomethyl-Histone H3 (Lys36) Antibody Trial Size is a rabbit polyclonal for detection of Histone H3 monomethylated at lysine 36. Also known as Anti-H3K36me1, this antibody has dot blot (DB) proven specificity & has been validated in WB, IP. Small pack size is ideal for screening applications. pricing
ABE1304 Anti-monomethyl Histone H3 (Lys4) Antibody 100 µg, Anti-monomethyl Histone H3 (Lys4) is an antibody against monomethyl Histone H3 (Lys4) for use in WB, IP, IH, Dot Blot. pricing
ABE1353 Anti-monomethyl Histone H3 (Lys4) Antibody 50 µg, This Anti-monomethyl Histone H3 (Lys4) Antibody is validated for use in Western Blotting and ELISA and Dot Blot and Chromatin Immunoprecipitation (ChIP) and ChIP-seq and Immunocytochemistry for the detection of monomethyl Histone H3 (Lys4). pricing
07-450 Anti-monomethyl-Histone H3 (Lys9) Antibody 100 µg, Anti-monomethyl-Histone H3 (Lys9) Antibody is a Rabbit Polyclonal Antibody for detection of Histone H3 monomethylated on lysine 9 (H3K9me1). This purified antibody is specificity verified by dot blot (DB), published in peer reviewed journals, and has been validated in ICC, PIA & WB. pricing
ABE101 Anti-monomethyl-Histone H3 (Lys9) Antibody 100 µg, Anti-monomethyl-Histone H3 (Lys9) Antibody is a Rabbit Polyclonal Antibody for detection of Histone H3 monomethylated on lysine 9. This purified Ab, also known as Anti-H3K9me1 has dot blot proven specificity and is validated in WB, ICC, PIA. pricing
07-450-S Anti-monomethyl-Histone H3 (Lys9) Antibody, Trial Size 10 µg, Anti-monomethyl-Histone H3 (Lys9) Antibody, Trial Size is a purified rabbit polyclonal that detects Histone H3 monomethylated on lysine 9 (H3K9me1). This Ab is specificity verified by dot blot (DB), and validated in ICC, PIA, WB. The small pack size is ideal for screening applications. pricing
ABE101-S Anti-monomethyl-Histone H3 (Lys9) Antibody, Trial Size 10 µg, Anti-monomethyl-Histone H3 (Lys9) Antibody, Trial Size is a rabbit polyclonal for detection of Histone H3 monomethylated on lysine 9. Also known as H3K9me1, this antibody has dot blot proven specificity, and has been validated in WB, ICC, PIA. Small pack size is ideal for screening. pricing
06-570-AF555 Anti-phospho-H3 Antibody (Ser10), Alexa Fluor® 555 Conjugate 100 µL, Anti-phospho-H3 (Ser10), Alexa Fluor® 555 Conjugate is a purified rabbit polyclonal Antibody that detects Histone H3 phosphorylated at serine 10. This Ab is labeled with Alexa Fluor 555 and validated for use in IC. The unconjugated version of this antibody is published & proven in ICC, IP & WB. pricing
FCMAB104A4 Anti-phospho H3 (Ser10) Antibody, clone 3H10 Alexa Fluor® 488 100 tests, Anti-Phospho-Histone H3 (Ser10) Antibody, clone 3H10, Alexa Fluor® 488, is a Mouse Monoclonal Antibody for detection of Histone H3 phosphorylated at serine 10. This purified mAb, also known as H3S10p,
is labeled with Alexa Fluor® 488 and validated for use in FC.
pricing
MABE941 Anti-phospho Histone H3.1 (Ser28), clone 5D10D4 Antibody 100 µg, This Anti-phospho Histone H3.1 (Ser28), clone 5D10D4 Antibody is validated for use in Western Blotting and Dot Blot and Immunocytochemistry and ELISA and Chromatin Immunoprecipitation (ChIP) and ChIP-seq for the detection of phospho Histone H3.1 (Ser28). pricing
06-570-AF647 Anti-phospho Histone H3 (Ser10), Alexa Fluor® 647 Conjugate Antibody 100 µL, Anti-phospho-H3 (Ser10), Alexa Fluor® 647 Conjugate is a purified rabbit polyclonal antibody to detect Histone H3 phosphorylated at serine 10. This Ab is labeled with Alexa Fluor 647 and validated for use in IC. The unconjugated version of this antibody is published and proven in ICC, IP & WB. pricing
06-570-AF488 Anti-phospho Histone H3 (Ser10) Antibody, Alexa Fluor® 488 Conjugate 100 µL, Anti-phospho-H3 (Ser10), Alexa Fluor® 488 Conjugate is a purified rabbit polyclonal that detects Histone H3 phosphorylated at serine 10. This Ab is labeled with Alexa Fluor 488 and validated in IC. The unconjugated version of this antibody is highly published and proven in ICC, IP & WB. pricing
16-189 Anti-phospho-Histone H3 (Ser10) Antibody, biotin conjugate 100 µg, Anti-phospho-Histone H3 (Ser10) Antibody, biotin conjugate is a Rabbit Polyclonal Antibody for detection of Histone H3 phosphorylated at serine 10. This purified mAb, also known as H3S10p,is biotinylated, published in peer reviewed journals and has been validated in WB, ICC. pricing
05-806 Anti-phospho-Histone H3 (Ser10) Antibody, clone 3H10 100 µg, Anti-phospho-Histone H3 (Ser10) Antibody, clone 3H10 is a mouse monoclonal antibody for detection of Histone H3 phosphorylated at serine 10. This purified mAb, also known as H3S10p, is published in peer reviewed journals and has been validated in FC, ICC, IF, PIA, WB, Mplex. pricing
16-218 Anti-Phospho-Histone H3 (Ser10) Antibody, clone 3H10, Cy5 conjugate 100 µg, Anti-Phospho-Histone H3 (Ser10) Antibody, clone 3H10, Cy5 Conjugate is a Mouse Monoclonal Antibody for detection of Histone H3 phosphorylated at serine 10. This purified mAb, also known as H3S10p,
is labeled with Cy5.5 NHS ester (Cy5), and validated in IF, WB.
pricing
16-222 Anti-Phospho-Histone H3 (Ser10) Antibody, clone 3H10, FITC Conjugate 100 µg, Anti-Phospho-Histone H3 (Ser10) Antibody, clone 3H10, FITC Conjugate is a Mouse Monoclonal for detection of Histone H3 phosphorylated at serine 10. This mAb, also known as H3S10p,is labeled with Fluorescein isothiocyanate (FITC), published in peer reviewed journals & validated in WB, ICC & IF. pricing
05-817R-I Anti-phospho-Histone H3 (Ser10) Antibody, clone 63-1C-8, Recombinant 100 µL, Anti-phospho-Histone H3 (Ser10) Antibody, clone 63-1C-8, is a recombinant rabbit monoclonal antibody that detects Histone H3 phosphorylated at serine 10. This purified recombinant mAb, also known as Anti-H3S10p, is published and validated in WB, Flow Cytometry, and is specificity verified by DB. pricing
04-817 Anti-phospho-Histone H3 (Ser10) Antibody, clone MC463, rabbit monoclonal 100 µL, Anti-phospho-Histone H3 (Ser10) Antibody, clone MC463 is a rabbit monoclonal antibody for detection of Histone H3 phosphorylated at serine 10. This mAb, also known as H3S10p, is specificity verified using DB & Mplex, published in peer reviewed journals & validated in ChIP, IF, WB, ICC, ChIP-seq. pricing
05-598 Anti-phospho-Histone H3 (Ser10) Antibody, clone RR002 200 µg, Anti-phospho-Histone H3 (Ser10) Antibody, clone RR002 is a Mouse Monoclonal Antibody for detection of Histone H3 phosphorylated at serine 10. This purified mAb, also known as Anti-H3S10p, is published in peer reviewed journals and is validated in ICC, IHC, WB. pricing
06-570 Anti-phospho-Histone H3 (Ser10) Antibody, Mitosis Marker 200 µg, Anti-phospho-Histone H3 (Ser10) Antibody, Mitosis Marker is a Rabbit Polyclonal Antibody for detection of Histone H3 phosphorylated at serine 10.This highly published Ab, also known as Anti-H3S10p, has been validated in ICC, IP & WB. pricing
05-806-AF647 Anti-phospho Histone H3 (Ser10), clone 3H10, Alexa Fluor® 647 Antibody 100 µL, This Anti-phospho Histone H3 (Ser10) antibody, clone 3H10, Alexa Fluor® 647 is a purified mouse monoclonal for detection of Histone H3 phosphorylated at serine 10.
This mAb is fluorescently labeled and validated for use in IC. The unconjugated version has been proven in FC, ICC, IF, PIA, WB, Mplex.
pricing
ABE219 Anti-phospho Histone H3 (Ser57) Antibody 100 µg, This Anti-phospho Histone H3 (Ser57) Antibody is validated for use in western blotting, ICC, IP & dot blot for the detection of phospho Histone H3 (Ser57). pricing
ABE219-S Anti-phospho Histone H3 (Ser57) Antibody, Trial Size 10 µg, This Anti-phospho Histone H3 (Ser57) Antibody, Trial Size is validated for use in western blotting, ICC, IP & dot blot for the detection of phospho Histone H3 (Ser57). pricing
05-746R Anti-phospho-Histone H3 (Thr3) Antibody, clone JY325, rabbit monoclonal 100 µL, Anti-phospho-Histone H3 (Thr3) Antibody, clone JY325 is a Rabbit Monoclonal Antibody for detection of phospho-Histone H3 (Thr3) also known as Histone H3.1 & has been validated in WB, PIA. pricing
MABE944 Anti-phospho Histone H3 (Thr32), clone 6C7G12 Antibody 200 µg, This Anti-phospho Histone H3 (Thr32), clone 6C7G12 Antibody is validated for use in Western Blotting and ELISA and Immunocytochemistry and Chromatin Immunoprecipitation (ChIP) and ChIP-seq for the detection of phospho Histone H3 (Thr32). pricing
ABE1413 Anti-phospho Histone H3 (Tyr41) Antibody 100 µg, This Anti-phospho Histone H3 (Tyr41) Antibody is validated for use in Western Blotting and Dot Blot and Immunohistochemistry for the detection of phospho Histone H3 (Tyr41). pricing
ABE566 Anti-phospho Histone H3 (Tyr41) Antibody| ABE566 100 µg, This Anti-phospho Histone H3 (Tyr41) Antibody is validated for use in western blotting, ICC & dot blot for the detection of phospho Histone H3 (Tyr41). pricing
07-081 Anti-phospho (Ser10)-acetyl (Lys14)-Histone H3 Antibody 100 µL, Anti-phospho (Ser10)-acetyl (Lys14)-Histone H3 Antibody is a rabbit polyclonal that detects Histone 3 phosphorylated at serine 10 and acetylated at lysine 14. This highly specific antibody, also known as Anti-H3S10pK14ac is published in peer reviewed journals & validated in ChIP, ICC, WB, ChIP-seq. pricing
ABE289 Anti-trimethyl-Histone H3 (Lys18) Antibody 100 µL, Anti-trimethyl-Histone H3 (Lys18) Antibody is a Rabbit Polyclonal Antibody for detection of trimethyl-Histone H3 (Lys18) also known as H3K18me3, Histone H3 (tri methyl K18) & has been validated in WB. pricing
07-449 Anti-trimethyl-Histone H3 (Lys27) Antibody 200 µg, Anti-trimethyl-Histone H3 (Lys27), also known as Anti-H3K27me3, is a highly published Rabbit Polyclonal Antibody. This protein A purified antibody is dot blot tested for trimethylated lysine 27 specificity and validated in WB, ChIP, ChIP-seq, ICC, IP. pricing
ABE44 Anti-trimethyl Histone H3 (Lys27) Antibody 100 µg, Anti-trimethyl Histone H3 (Lys27) Antibody is a rabbit polyclonal antibody for detection of Histone H3 trimethylated on lysine 27( H3K27me3). This purified polyclonal is specificity verified by dot blot (DB), published in peer reviewed journals and validated in WB, ICC, PIA. pricing
ABE44-S Anti-trimethyl Histone H3 (Lys27) Antibody, Trial Size 10 µg, Anti-trimethyl Histone H3 (Lys27) Antibody is a rabbit polyclonal antibody for detection of Histone H3 trimethylated on lysine 27 (H3K73me). This purified Ab is specificity verified by dot blot (DB) & validated in WB, ICC, PIA. Small pack size is ideal for screening applications. pricing
ABE305 Anti-trimethyl Histone H3 (Lys36) Antibody 100 µL, Use Anti-trimethyl Histone H3 (Lys36) Antibody (Rabbit Polyclonal Antibody) validated in WB, DB, ICC, ChIP to detect trimethyl Histone H3 (Lys36) also known as H3K36me3, Histone H3 (tri methyl K36). pricing
ABE435 Anti-trimethyl-Histone H3 (Lys36) Antibody 200 µL, Anti-trimethyl-Histone H3 (Lys36) Antibody is a rabbit polyclonal antibody for detection of Histone H3 trimethylated at lysine 36. Also known as Anti-H3K36me3, this purified Ab is specificity verified by dot blot (DB) and has been validated in WB, ICC, DB, ChIP, ChIP-seq. pricing
ABE305-S Anti-trimethyl Histone H3 (Lys36) Antibody, Trial Size 10 µL, Use Anti-trimethyl Histone H3 (Lys36) Antibody (rabbit polyclonal antibody), Trial Size/ Pack validated in WB, DB, ICC, ChIP to detect trimethyl Histone H3 (Lys36) also known as H3K36me3, Histone H3 (tri methyl K36). pricing
ABE435-S Anti-trimethyl-Histone H3 (Lys36) Antibody, Trial Size 20 µL, Anti-trimethyl-Histone H3 (Lys36) Antibody, Trial Size, is a rabbit polyclonal antibody for detection of Histone H3 trimethylated at lysine 36 (H3K36me3). This purified Ab is specificity verified by dot blot (DB) and validated in WB, ICC. Small pack size is ideal for screening applications. pricing
07-473-AF555 Anti-trimethyl Histone H3 (Lys4) Antibody, Alexa Fluor® 555 Conjugate 100 µL, This Anti-trimethyl Histone H3 (Lys4) Antibody, Alexa Fluor® 555 Conjugate is validated for use in Immunocytochemistry for the detection of trimethyl Histone H3. pricing
ABE1352 Anti- trimethyl Histone H3 (Lys9) Antibody 50 µg, This Anti- trimethyl Histone H3 (Lys9) Antibody is validated for use in Western Blotting and Immunocytochemistry and Chromatin Immunoprecipitation (ChIP) and ChIP-seq and ELISA and Dot Blot for the detection of trimethyl Histone H3 (Lys9). pricing
MABE263 Anti-unmethylated-Histone H3 (Lys9) Antibody, clone 9B1-2G6 100 µg, Use Anti-unmethylated-Histone H3 (Lys9) Antibody, clone 9B1-2G6 (Mouse Monoclonal Antibody) demonstrated to detect unmethylated-Histone H3 (Lys9) also known as Histone H3.1. pricing
MABE263-AF647 Anti-unmethylated Histone H3 (Lys9) Antibody, clone 9B1-2G6, Alexa Fluor® 647 Conjugate 100 µL, This Anti-unmethylated Histone H3 (Lys9) Antibody, clone 9B1-2G6 is validated for use in Immunocytochemistry for the detection of unmethylated Histone H3 (Lys9). pricing
MABE263-S Anti-unmethylated-Histone H3 (Lys9) Antibody, clone 9B1-2G6, Trial Size 10 µg, Use Anti-unmethylated-Histone H3 (Lys9) Antibody, clone 9B1-2G6 (Mouse Monoclonal Antibody) demonstrated to detect unmethylated-Histone H3 (Lys9) also known as Histone H3.1. pricing
17-10259 ChIPAb+ Acetyl-Histone H3 (Lys56) - ChIP Validated Antibody and Primer Set 25 assays, This ChIPAb+ Acetyl-Histone H3 (Lys56) -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003536 Rosetta Predictions human pricing
XM_001057500 Rosetta Predictions rat pricing
NM_178206 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335802 predicted 97
2 SASI_Hs02_00335803 predicted 100
3 SASI_Hs01_00051252 predicted 119
4 SASI_Hs02_00335804 predicted 182
5 SASI_Hs02_00335805 predicted 94
6 SASI_Hs02_00335806 predicted 92
7 SASI_Hs02_00335807 predicted 100
8 SASI_Hs02_00335808 predicted 100
9 SASI_Hs01_00051257 predicted 130
10 SASI_Hs01_00051249 predicted 421
11 SASI_Hs01_00051250 predicted 421
12 SASI_Hs01_00051251 predicted 426
13 SASI_Hs01_00051253 predicted 435
14 SASI_Hs01_00051254 predicted 414
15 SASI_Hs01_00051255 predicted 417
16 SASI_Hs01_00051256 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286607 predicted 102
2 SASI_Rn02_00286608 predicted 79
3 SASI_Rn02_00286609 predicted 84
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178206 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054051 predicted 433
2 SASI_Mm01_00054052 predicted 436
3 SASI_Mm01_00054053 predicted 430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178206
HIST1H3H MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H3h
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-228s1c1
Sequence:CCGGGCAGGACTTCAAGACCGACCTCTCGAGAGGTCGGTCTTGAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-183s1c1
Sequence:CCGGGCTGATCCGCAAGCTGCCGTTCTCGAGAACGGCAGCTTGCGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-159s1c1
Sequence:CCGGGCGCTACCAGAAGTCGACCGACTCGAGTCGGTCGACTTCTGGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-252s1c1
Sequence:CCGGCTTCCAGAGCTCGGCCGTCATCTCGAGATGACGGCCGAGCTCTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-177s1c1
Sequence:CCGGCGAGCTGCTGATCCGCAAGCTCTCGAGAGCTTGCGGATCAGCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178206
HIST1H3H MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H3h
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-228s1c1
Sequence:CCGGGCAGGACTTCAAGACCGACCTCTCGAGAGGTCGGTCTTGAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-183s1c1
Sequence:CCGGGCTGATCCGCAAGCTGCCGTTCTCGAGAACGGCAGCTTGCGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-159s1c1
Sequence:CCGGGCGCTACCAGAAGTCGACCGACTCGAGTCGGTCGACTTCTGGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-252s1c1
Sequence:CCGGCTTCCAGAGCTCGGCCGTCATCTCGAGATGACGGCCGAGCTCTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-177s1c1
Sequence:CCGGCGAGCTGCTGATCCGCAAGCTCTCGAGAGCTTGCGGATCAGCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178206
HIST1H3H MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H3h
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-228s1c1
Sequence:CCGGGCAGGACTTCAAGACCGACCTCTCGAGAGGTCGGTCTTGAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-183s1c1
Sequence:CCGGGCTGATCCGCAAGCTGCCGTTCTCGAGAACGGCAGCTTGCGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-159s1c1
Sequence:CCGGGCGCTACCAGAAGTCGACCGACTCGAGTCGGTCGACTTCTGGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-252s1c1
Sequence:CCGGCTTCCAGAGCTCGGCCGTCATCTCGAGATGACGGCCGAGCTCTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-177s1c1
Sequence:CCGGCGAGCTGCTGATCCGCAAGCTCTCGAGAGCTTGCGGATCAGCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003536
HIST1H3H MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H3h
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-126s1c1
Sequence:CCGGCCCATCGCTATCGGCCTGGTACTCGAGTACCAGGCCGATAGCGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-128s1c1
Sequence:CCGGCATCGCTATCGGCCTGGTACACTCGAGTGTACCAGGCCGATAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-238s1c1
Sequence:CCGGGCAGGACTTCAAGACCGACTTCTCGAGAAGTCGGTCTTGAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-144s1c1
Sequence:CCGGGTACAGTGGCTCTCCGCGAGACTCGAGTCTCGCGGAGAGCCACTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-193s1c1
Sequence:CCGGGCTGATCAGAAAGCTGCCTTTCTCGAGAAAGGCAGCTTTCTGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-162s21c1
Sequence:CCGGAGATTCGCCGCTACCAGAAGTCTCGAGACTTCTGGTAGCGGCGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-383s21c1
Sequence:CCGGATCCAGCTCGCACGTCGTATCCTCGAGGATACGACGTGCGAGCTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-351s21c1
Sequence:CCGGACGCCAAGCGGGTGACTATCACTCGAGTGATAGTCACCCGCTTGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-214s21c1
Sequence:CCGGTCAGCGTCTGGTGCGTGAGATCTCGAGATCTCACGCACCAGACGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003536
HIST1H3H MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H3h
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-126s1c1
Sequence:CCGGCCCATCGCTATCGGCCTGGTACTCGAGTACCAGGCCGATAGCGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-128s1c1
Sequence:CCGGCATCGCTATCGGCCTGGTACACTCGAGTGTACCAGGCCGATAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-238s1c1
Sequence:CCGGGCAGGACTTCAAGACCGACTTCTCGAGAAGTCGGTCTTGAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-144s1c1
Sequence:CCGGGTACAGTGGCTCTCCGCGAGACTCGAGTCTCGCGGAGAGCCACTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-193s1c1
Sequence:CCGGGCTGATCAGAAAGCTGCCTTTCTCGAGAAAGGCAGCTTTCTGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-162s21c1
Sequence:CCGGAGATTCGCCGCTACCAGAAGTCTCGAGACTTCTGGTAGCGGCGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-383s21c1
Sequence:CCGGATCCAGCTCGCACGTCGTATCCTCGAGGATACGACGTGCGAGCTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-351s21c1
Sequence:CCGGACGCCAAGCGGGTGACTATCACTCGAGTGATAGTCACCCGCTTGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-214s21c1
Sequence:CCGGTCAGCGTCTGGTGCGTGAGATCTCGAGATCTCACGCACCAGACGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003536
HIST1H3H MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H3h
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-126s1c1
Sequence:CCGGCCCATCGCTATCGGCCTGGTACTCGAGTACCAGGCCGATAGCGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-128s1c1
Sequence:CCGGCATCGCTATCGGCCTGGTACACTCGAGTGTACCAGGCCGATAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-238s1c1
Sequence:CCGGGCAGGACTTCAAGACCGACTTCTCGAGAAGTCGGTCTTGAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-144s1c1
Sequence:CCGGGTACAGTGGCTCTCCGCGAGACTCGAGTCTCGCGGAGAGCCACTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-193s1c1
Sequence:CCGGGCTGATCAGAAAGCTGCCTTTCTCGAGAAAGGCAGCTTTCTGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-162s21c1
Sequence:CCGGAGATTCGCCGCTACCAGAAGTCTCGAGACTTCTGGTAGCGGCGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-383s21c1
Sequence:CCGGATCCAGCTCGCACGTCGTATCCTCGAGGATACGACGTGCGAGCTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-351s21c1
Sequence:CCGGACGCCAAGCGGGTGACTATCACTCGAGTGATAGTCACCCGCTTGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-214s21c1
Sequence:CCGGTCAGCGTCTGGTGCGTGAGATCTCGAGATCTCACGCACCAGACGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks