EMAIL THIS PAGE TO A FRIEND

HIST2H2BB

histone cluster 2, H2bb (pseudogene)

Gene ID:
Mouse(319189) histone cluster 2, H2bb
Rat(295278) histone cluster 2, H2bb
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175666 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175666 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175666 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001059297 Rosetta Predictions rat pricing
XM_001059351 Rosetta Predictions rat pricing
XM_001070049 Rosetta Predictions rat pricing
XM_227463 Rosetta Predictions rat pricing
NM_175666 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292747 predicted 752
2 SASI_Rn02_00292748 predicted 748
3 SASI_Rn02_00292749 predicted 822
4 SASI_Rn02_00292750 predicted 550
5 SASI_Rn02_00292751 predicted 400
6 SASI_Rn02_00292752 predicted 513
7 SASI_Rn02_00292753 predicted 369
8 SASI_Rn02_00292754 predicted 203
9 SASI_Rn02_00292755 predicted 823
10 SASI_Rn02_00292756 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059351 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292933 predicted 445
2 SASI_Rn02_00292934 predicted 213
3 SASI_Rn02_00292935 predicted 439
4 SASI_Rn02_00292936 predicted 207
5 SASI_Rn02_00292937 predicted 417
6 SASI_Rn02_00292938 predicted 237
7 SASI_Rn02_00292939 predicted 429
8 SASI_Rn02_00292940 predicted 445
9 SASI_Rn02_00292941 predicted 417
10 SASI_Rn02_00292942 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070049 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330244 predicted 248
2 SASI_Rn02_00330245 predicted 205
3 SASI_Rn02_00330246 predicted 210
4 SASI_Rn02_00330247 predicted 270
5 SASI_Rn02_00330248 predicted 205
6 SASI_Rn02_00330249 predicted 255
7 SASI_Rn02_00330250 predicted 225
8 SASI_Rn02_00330251 predicted 272
9 SASI_Rn02_00330252 predicted 212
10 SASI_Rn02_00330253 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227463 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384421 predicted 447
2 SASI_Rn02_00384422 predicted 213
3 SASI_Rn02_00384423 predicted 441
4 SASI_Rn02_00384424 predicted 216
5 SASI_Rn02_00384425 predicted 422
6 SASI_Rn02_00384426 predicted 232
7 SASI_Rn02_00384427 predicted 436
8 SASI_Rn02_00384428 predicted 440
9 SASI_Rn02_00384429 predicted 423
10 SASI_Rn02_00384430 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145335 predicted 240
2 SASI_Mm01_00145336 predicted 214
3 SASI_Mm01_00145337 predicted 214
4 SASI_Mm01_00145338 predicted 241
5 SASI_Mm01_00145339 predicted 198
6 SASI_Mm01_00145340 predicted 230
7 SASI_Mm01_00145341 predicted 210
8 SASI_Mm01_00145342 predicted 216
9 SASI_Mm01_00145343 predicted 219
10 SASI_Mm01_00145344 predicted 235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175666
HIST2H2BB MISSION shRNA Bacterial Glycerol Stock
histone cluster 2, H2bb (pseudogene)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000200886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175666.1-2058s1c1
Sequence:CCGGGCCGTAATAGTTCCCTTAATTCTCGAGAATTAAGGGAACTATTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175666.1-2059s1c1
Sequence:CCGGCCGTAATAGTTCCCTTAATTTCTCGAGAAATTAAGGGAACTATTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175666.1-157s1c1
Sequence:CCGGCTACTCCATCTATGTGTACAACTCGAGTTGTACACATAGATGGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175666.1-747s1c1
Sequence:CCGGCGACTTAAAGTGAGATGGTTTCTCGAGAAACCATCTCACTTTAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175666
HIST2H2BB MISSION shRNA shRNA Plasmid DNA
histone cluster 2, H2bb (pseudogene)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000200886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175666.1-2058s1c1
Sequence:CCGGGCCGTAATAGTTCCCTTAATTCTCGAGAATTAAGGGAACTATTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175666.1-2059s1c1
Sequence:CCGGCCGTAATAGTTCCCTTAATTTCTCGAGAAATTAAGGGAACTATTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175666.1-157s1c1
Sequence:CCGGCTACTCCATCTATGTGTACAACTCGAGTTGTACACATAGATGGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175666.1-747s1c1
Sequence:CCGGCGACTTAAAGTGAGATGGTTTCTCGAGAAACCATCTCACTTTAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175666
HIST2H2BB MISSION shRNA Lentiviral Transduction Particles
histone cluster 2, H2bb (pseudogene)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000200886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175666.1-2058s1c1
Sequence:CCGGGCCGTAATAGTTCCCTTAATTCTCGAGAATTAAGGGAACTATTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175666.1-2059s1c1
Sequence:CCGGCCGTAATAGTTCCCTTAATTTCTCGAGAAATTAAGGGAACTATTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175666.1-157s1c1
Sequence:CCGGCTACTCCATCTATGTGTACAACTCGAGTTGTACACATAGATGGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175666.1-747s1c1
Sequence:CCGGCGACTTAAAGTGAGATGGTTTCTCGAGAAACCATCTCACTTTAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks