EMAIL THIS PAGE TO A FRIEND

HIST2H2BE

histone cluster 2, H2be

Synonyms: GL105 H2B H2B.1 H2BFQ H2BGL105 H2BQ
UniProtKB ID: Q16778, A3KMC7, A8K110, Q4KMY1, Q5QNX0, Q9UE88
Gene ID:
Human(8349) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a member of the histone H2B family, and generates two transcripts through the use of the conserved stem-loop termination motif, and the polyA addition motif. [provided by RefSeq, Jul 2008]
Mouse(319190) histone cluster 2, H2be
Rat(295274) histone cluster 2, H2be
cow(537985) histone cluster 2, H2be
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178214 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178214 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178214 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003528 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003528 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003528 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003528 Rosetta Predictions human pricing
XM_001061909 Rosetta Predictions rat pricing
XM_227459 Rosetta Predictions rat pricing
NM_178214 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143847 predicted 801
2 SASI_Hs01_00143848 predicted 810
3 SASI_Hs01_00143850 predicted 877
4 SASI_Hs01_00143851 predicted 630
5 SASI_Hs02_00335798 predicted 804
6 SASI_Hs01_00143852 predicted 466
7 SASI_Hs01_00143853 predicted 704
8 SASI_Hs01_00143854 predicted 694
9 SASI_Hs01_00143855 predicted 700
10 SASI_Hs01_00143856 predicted 568
11 SASI_Hs01_00143849 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301763 predicted 619
2 SASI_Rn02_00301764 predicted 506
3 SASI_Rn02_00301765 predicted 320
4 SASI_Rn02_00301766 predicted 651
5 SASI_Rn02_00301767 predicted 817
6 SASI_Rn02_00301768 predicted 839
7 SASI_Rn02_00301769 predicted 580
8 SASI_Rn02_00301770 predicted 529
9 SASI_Rn02_00301771 predicted 643
10 SASI_Rn02_00301772 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384411 predicted 618
2 SASI_Rn02_00384412 predicted 502
3 SASI_Rn02_00384413 predicted 317
4 SASI_Rn02_00384414 predicted 647
5 SASI_Rn02_00384415 predicted 812
6 SASI_Rn02_00384416 predicted 833
7 SASI_Rn02_00384417 predicted 579
8 SASI_Rn02_00384418 predicted 530
9 SASI_Rn02_00384419 predicted 641
10 SASI_Rn02_00384420 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022795 predicted 733
2 SASI_Mm01_00022796 predicted 339
3 SASI_Mm01_00022797 predicted 515
4 SASI_Mm01_00022798 predicted 645
5 SASI_Mm01_00022799 predicted 753
6 SASI_Mm01_00022800 predicted 528
7 SASI_Mm01_00022801 predicted 616
8 SASI_Mm01_00022802 predicted 540
9 SASI_Mm01_00022803 predicted 338
10 SASI_Mm01_00022804 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178214
HIST2H2BE MISSION shRNA Bacterial Glycerol Stock
histone cluster 2, H2be
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178214.2-2058s1c1
Sequence:CCGGGCCGTAATAGTTCCCTTAATTCTCGAGAATTAAGGGAACTATTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178214.2-300s1c1
Sequence:CCGGACAAGCGGTCTACAATCACATCTCGAGATGTGATTGTAGACCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178214.2-310s1c1
Sequence:CCGGTACAATCACATCGCGGGAGATCTCGAGATCTCCCGCGATGTGATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178214.2-253s1c1
Sequence:CCGGCATCTTTGAGCGCATAGCAAACTCGAGTTTGCTATGCGCTCAAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178214.2-293s1c1
Sequence:CCGGCATTACAACAAGCGGTCTACACTCGAGTGTAGACCGCTTGTTGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178214
HIST2H2BE MISSION shRNA shRNA Plasmid DNA
histone cluster 2, H2be
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178214.2-2058s1c1
Sequence:CCGGGCCGTAATAGTTCCCTTAATTCTCGAGAATTAAGGGAACTATTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178214.2-300s1c1
Sequence:CCGGACAAGCGGTCTACAATCACATCTCGAGATGTGATTGTAGACCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178214.2-310s1c1
Sequence:CCGGTACAATCACATCGCGGGAGATCTCGAGATCTCCCGCGATGTGATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178214.2-253s1c1
Sequence:CCGGCATCTTTGAGCGCATAGCAAACTCGAGTTTGCTATGCGCTCAAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178214.2-293s1c1
Sequence:CCGGCATTACAACAAGCGGTCTACACTCGAGTGTAGACCGCTTGTTGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178214
HIST2H2BE MISSION shRNA Lentiviral Transduction Particles
histone cluster 2, H2be
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178214.2-2058s1c1
Sequence:CCGGGCCGTAATAGTTCCCTTAATTCTCGAGAATTAAGGGAACTATTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178214.2-300s1c1
Sequence:CCGGACAAGCGGTCTACAATCACATCTCGAGATGTGATTGTAGACCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178214.2-310s1c1
Sequence:CCGGTACAATCACATCGCGGGAGATCTCGAGATCTCCCGCGATGTGATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178214.2-253s1c1
Sequence:CCGGCATCTTTGAGCGCATAGCAAACTCGAGTTTGCTATGCGCTCAAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178214.2-293s1c1
Sequence:CCGGCATTACAACAAGCGGTCTACACTCGAGTGTAGACCGCTTGTTGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003528
HIST2H2BE MISSION shRNA Bacterial Glycerol Stock
histone cluster 2, H2be
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000106720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003528.2-1194s1c1
Sequence:CCGGCCATGTAGATACGGGCTCAAACTCGAGTTTGAGCCCGTATCTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003528.2-108s1c1
Sequence:CCGGCCAGAAGAAAGACGGCAAGAACTCGAGTTCTTGCCGTCTTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003528.2-141s1c1
Sequence:CCGGCCGCAAAGAGAGCTACTCCATCTCGAGATGGAGTAGCTCTCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003528.2-97s1c1
Sequence:CCGGGTCACCAAAGCCCAGAAGAAACTCGAGTTTCTTCTGGGCTTTGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003528
HIST2H2BE MISSION shRNA shRNA Plasmid DNA
histone cluster 2, H2be
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000106720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003528.2-1194s1c1
Sequence:CCGGCCATGTAGATACGGGCTCAAACTCGAGTTTGAGCCCGTATCTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003528.2-108s1c1
Sequence:CCGGCCAGAAGAAAGACGGCAAGAACTCGAGTTCTTGCCGTCTTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003528.2-141s1c1
Sequence:CCGGCCGCAAAGAGAGCTACTCCATCTCGAGATGGAGTAGCTCTCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003528.2-97s1c1
Sequence:CCGGGTCACCAAAGCCCAGAAGAAACTCGAGTTTCTTCTGGGCTTTGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003528
HIST2H2BE MISSION shRNA Lentiviral Transduction Particles
histone cluster 2, H2be
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000106720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003528.2-1194s1c1
Sequence:CCGGCCATGTAGATACGGGCTCAAACTCGAGTTTGAGCCCGTATCTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003528.2-108s1c1
Sequence:CCGGCCAGAAGAAAGACGGCAAGAACTCGAGTTCTTGCCGTCTTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003528.2-141s1c1
Sequence:CCGGCCGCAAAGAGAGCTACTCCATCTCGAGATGGAGTAGCTCTCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003528.2-97s1c1
Sequence:CCGGGTCACCAAAGCCCAGAAGAAACTCGAGTTTCTTCTGGGCTTTGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks