EMAIL THIS PAGE TO A FRIEND

HIST2H3D

histone cluster 2, H3d

Species: Human HIST2H3D(653604)
Gene ID:
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001123375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001123375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001123375 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123375 Rosetta Predictions human pricing
XM_497711 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327834 predicted 64
2 SASI_Hs02_00327835 predicted 63
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_497711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263125 predicted 65
2 SASI_Hs01_00263126 predicted 48
3 SASI_Hs01_00263127 predicted 42
4 SASI_Hs01_00263128 predicted 60
5 SASI_Hs01_00263129 predicted 54
6 SASI_Hs01_00263130 predicted 57
7 SASI_Hs01_00263131 predicted 48
8 SASI_Hs01_00263132 predicted 104
9 SASI_Hs01_00263133 predicted 192
10 SASI_Hs01_00263134 predicted 194
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001123375
HIST2H3D MISSION shRNA Bacterial Glycerol Stock
histone cluster 2, H3d
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123375.1-230s21c1
Sequence:CCGGAGGACTTTAAGACGGACCTGCCTCGAGGCAGGTCCGTCTTAAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123375.1-52s21c1
Sequence:CCGGAGGAAGCAGCTGGCTACCAAACTCGAGTTTGGTAGCCAGCTGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123375.1-360s21c1
Sequence:CCGGCATGCCCAAGGACATCCAGTTCTCGAGAACTGGATGTCCTTGGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123375.1-219s21c1
Sequence:CCGGCGAGATCGCGCAGGACTTTAACTCGAGTTAAAGTCCTGCGCGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123375.1-162s21c1
Sequence:CCGGCTACCAGAAGTCTACGGAGCTCTCGAGAGCTCCGTAGACTTCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001123375
HIST2H3D MISSION shRNA shRNA Plasmid DNA
histone cluster 2, H3d
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123375.1-230s21c1
Sequence:CCGGAGGACTTTAAGACGGACCTGCCTCGAGGCAGGTCCGTCTTAAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123375.1-52s21c1
Sequence:CCGGAGGAAGCAGCTGGCTACCAAACTCGAGTTTGGTAGCCAGCTGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123375.1-360s21c1
Sequence:CCGGCATGCCCAAGGACATCCAGTTCTCGAGAACTGGATGTCCTTGGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123375.1-219s21c1
Sequence:CCGGCGAGATCGCGCAGGACTTTAACTCGAGTTAAAGTCCTGCGCGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123375.1-162s21c1
Sequence:CCGGCTACCAGAAGTCTACGGAGCTCTCGAGAGCTCCGTAGACTTCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001123375
HIST2H3D MISSION shRNA Lentiviral Transduction Particles
histone cluster 2, H3d
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123375.1-230s21c1
Sequence:CCGGAGGACTTTAAGACGGACCTGCCTCGAGGCAGGTCCGTCTTAAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123375.1-52s21c1
Sequence:CCGGAGGAAGCAGCTGGCTACCAAACTCGAGTTTGGTAGCCAGCTGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123375.1-360s21c1
Sequence:CCGGCATGCCCAAGGACATCCAGTTCTCGAGAACTGGATGTCCTTGGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123375.1-219s21c1
Sequence:CCGGCGAGATCGCGCAGGACTTTAACTCGAGTTAAAGTCCTGCGCGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123375.1-162s21c1
Sequence:CCGGCTACCAGAAGTCTACGGAGCTCTCGAGAGCTCCGTAGACTTCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks