EMAIL THIS PAGE TO A FRIEND

HK2

hexokinase 2

Synonyms: HKII HXK2
UniProtKB ID: P52789, D6W5J2, Q8WU87, Q9UN82
Gene ID:
Human(3099) Summary: Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes hexokinase 2, the predominant form found in skeletal muscle. It localizes to the outer membrane of mitochondria. Expression of this gene is insulin-responsive, and studies in rat suggest that it is involved in the increased rate of glycolysis seen in rapidly growing cancer cells. [provided by RefSeq, Apr 2009]
Mouse(15277) hexokinase 2
Rat(25059) hexokinase 2
sheep(101107690) hexokinase 2
Zebrafish(406339) hexokinase 2
Thale Cress(833552) histidine kinase 2
chicken(374044) hexokinase 2
cow(788926) hexokinase 2
Horse(100009677) hexokinase 2
dog(475781) hexokinase 2
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK091 Hexokinase Colorimetric Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013820 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013820 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013820 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000189 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000189 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000189 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU039591 MISSION® esiRNA esiRNA targeting mouse Hk2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000189 Rosetta Predictions human pricing
NM_012735 Rosetta Predictions rat pricing
NM_013820 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080105 predicted 4179
2 SASI_Hs01_00080106 predicted 2843
3 SASI_Hs01_00080107 predicted 4536
4 SASI_Hs01_00080108 predicted 2196
5 SASI_Hs01_00080109 predicted 4269
6 SASI_Hs01_00080110 predicted 2410
7 SASI_Hs01_00080111 predicted 3398
8 SASI_Hs01_00080112 predicted 4529
9 SASI_Hs01_00080113 predicted 2012
10 SASI_Hs02_00302040 predicted 4221
11 SASI_Hs01_00080104 predicted 4183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012735 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037498 predicted 2213
2 SASI_Rn02_00260083 predicted 1199
3 SASI_Rn01_00037500 predicted 791
4 SASI_Rn01_00037501 predicted 2439
5 SASI_Rn01_00037502 predicted 2190
6 SASI_Rn01_00037503 predicted 2830
7 SASI_Rn01_00037505 predicted 835
8 SASI_Rn02_00260084 predicted 285
9 SASI_Rn02_00260085 predicted 334
10 SASI_Rn01_00037506 predicted 2110
11 SASI_Rn01_00037499 predicted 601
12 SASI_Rn01_00037504 predicted 1220
13 SASI_Rn01_00037507 predicted 1773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013820 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172799 predicted 1474
2 SASI_Mm01_00172800 predicted 1071
3 SASI_Mm01_00172805 predicted 1491
4 SASI_Mm01_00172801 predicted 3110
5 SASI_Mm01_00172802 predicted 3076
6 SASI_Mm01_00172804 predicted 1893
7 SASI_Mm02_00322790 predicted 482
8 SASI_Mm01_00172806 predicted 565
9 SASI_Mm01_00172808 predicted 1154
10 SASI_Mm02_00322791 predicted 3220
11 SASI_Mm01_00172803 predicted 881
12 SASI_Mm01_00172807 predicted 1030
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013820
VALIDATED
HK2 MISSION shRNA Bacterial Glycerol Stock
hexokinase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013820.3-2431s21c1
Sequence:CCGGGCCGTGGTAAATGACACAGTTCTCGAGAACTGTGTCATTTACCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013820.3-1926s21c1
Sequence:CCGGGCTGGAGGTTAAGAGAAGGATCTCGAGATCCTTCTCTTAACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013820.3-3693s21c1
Sequence:CCGGCATCACCCTGCTGGTTCTAAACTCGAGTTTAGAACCAGCAGGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013820.3-2037s21c1
Sequence:CCGGCGGTACAGAGAAAGGAGACTTCTCGAGAAGTCTCCTTTCTCTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013820.1-3537s1c1
Sequence:CCGGGCGACATTTATAGGTGGAGAACTCGAGTTCTCCACCTATAAATGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013820.1-1931s1c1
Sequence:CCGGGCTGGAGGTTAAGAGAAGGATCTCGAGATCCTTCTCTTAACCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013820.1-2436s1c1
Sequence:CCGGGCCGTGGTAAATGACACAGTTCTCGAGAACTGTGTCATTTACCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013820.1-882s1c1
Sequence:CCGGGCCAACTTCATGGACAAGCTACTCGAGTAGCTTGTCCATGAAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013820.1-2042s1c1
Sequence:CCGGCGGTACAGAGAAAGGAGACTTCTCGAGAAGTCTCCTTTCTCTGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013820
VALIDATED
HK2 MISSION shRNA shRNA Plasmid DNA
hexokinase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013820.3-2431s21c1
Sequence:CCGGGCCGTGGTAAATGACACAGTTCTCGAGAACTGTGTCATTTACCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013820.3-1926s21c1
Sequence:CCGGGCTGGAGGTTAAGAGAAGGATCTCGAGATCCTTCTCTTAACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013820.3-3693s21c1
Sequence:CCGGCATCACCCTGCTGGTTCTAAACTCGAGTTTAGAACCAGCAGGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013820.3-2037s21c1
Sequence:CCGGCGGTACAGAGAAAGGAGACTTCTCGAGAAGTCTCCTTTCTCTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013820.1-3537s1c1
Sequence:CCGGGCGACATTTATAGGTGGAGAACTCGAGTTCTCCACCTATAAATGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013820.1-1931s1c1
Sequence:CCGGGCTGGAGGTTAAGAGAAGGATCTCGAGATCCTTCTCTTAACCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013820.1-2436s1c1
Sequence:CCGGGCCGTGGTAAATGACACAGTTCTCGAGAACTGTGTCATTTACCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013820.1-882s1c1
Sequence:CCGGGCCAACTTCATGGACAAGCTACTCGAGTAGCTTGTCCATGAAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013820.1-2042s1c1
Sequence:CCGGCGGTACAGAGAAAGGAGACTTCTCGAGAAGTCTCCTTTCTCTGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013820
VALIDATED
HK2 MISSION shRNA Lentiviral Transduction Particles
hexokinase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013820.3-2431s21c1
Sequence:CCGGGCCGTGGTAAATGACACAGTTCTCGAGAACTGTGTCATTTACCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013820.3-1926s21c1
Sequence:CCGGGCTGGAGGTTAAGAGAAGGATCTCGAGATCCTTCTCTTAACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013820.3-3693s21c1
Sequence:CCGGCATCACCCTGCTGGTTCTAAACTCGAGTTTAGAACCAGCAGGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013820.3-2037s21c1
Sequence:CCGGCGGTACAGAGAAAGGAGACTTCTCGAGAAGTCTCCTTTCTCTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013820.1-3537s1c1
Sequence:CCGGGCGACATTTATAGGTGGAGAACTCGAGTTCTCCACCTATAAATGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013820.1-1931s1c1
Sequence:CCGGGCTGGAGGTTAAGAGAAGGATCTCGAGATCCTTCTCTTAACCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013820.1-2436s1c1
Sequence:CCGGGCCGTGGTAAATGACACAGTTCTCGAGAACTGTGTCATTTACCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013820.1-882s1c1
Sequence:CCGGGCCAACTTCATGGACAAGCTACTCGAGTAGCTTGTCCATGAAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013820.1-2042s1c1
Sequence:CCGGCGGTACAGAGAAAGGAGACTTCTCGAGAAGTCTCCTTTCTCTGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000189
VALIDATED
HK2 MISSION shRNA Bacterial Glycerol Stock
hexokinase 2
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000189.4-2516s21c1
Sequence:CCGGGGGACTTTGATATCGACATTGCTCGAGCAATGTCGATATCAAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000189.4-4365s21c1
Sequence:CCGGTGACGACAGCATCATTGTTAACTCGAGTTAACAATGATGCTGTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000189.4-5921s21c1
Sequence:CCGGCTTAGGGCAGTCAGTAGTATTCTCGAGAATACTACTGACTGCCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000189.4-4188s21c1
Sequence:CCGGCCGTAACATTCTCATCGATTTCTCGAGAAATCGATGAGAATGTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000189.4-2207s21c1
Sequence:CCGGGGGTGAAAGTAACGGACAATGCTCGAGCATTGTCCGTTACTTTCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000189.4-2324s1c1
Sequence:CCGGGCCTGGCTAACTTCATGGATACTCGAGTATCCATGAAGTTAGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-2749s1c1
Sequence:CCGGACTGAGTTTGACCAGGAGATTCTCGAGAATCTCCTGGTCAAACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000189.4-2346s1c1
Sequence:CCGGGCTACAAATCAAAGACAAGAACTCGAGTTCTTGTCTTTGATTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000189.4-3937s1c1
Sequence:CCGGCACTGTGAAGTTGGCCTCATTCTCGAGAATGAGGCCAACTTCACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-4188s1c1
Sequence:CCGGCCGTAACATTCTCATCGATTTCTCGAGAAATCGATGAGAATGTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-4327s1c1
Sequence:CCGGCGAGCCATCCTGCAACACTTACTCGAGTAAGTGTTGCAGGATGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-2933s1c1
Sequence:CCGGCCAAAGACATCTCAGACATTGCTCGAGCAATGTCTGAGATGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000189.4-2334s1c1
Sequence:CCGGCTTCATGGATAAGCTACAAATCTCGAGATTTGTAGCTTATCCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-3336s1c1
Sequence:CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-6738s1c1
Sequence:CCGGGCTTGAAGATTAGGTACTATCCTCGAGGATAGTACCTAATCTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000189.4-2518s1c1
Sequence:CCGGGACTTTGATATCGACATTGTGCTCGAGCACAATGTCGATATCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000189.4-2297s1c1
Sequence:CCGGCCCAGCTGTTTGACCACATTGCTCGAGCAATGTGGTCAAACAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-1983s1c1
Sequence:CCGGGCAGAAGGTTGACCAGTATCTCTCGAGAGATACTGGTCAACCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000189
VALIDATED
HK2 MISSION shRNA shRNA Plasmid DNA
hexokinase 2
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000189.4-2516s21c1
Sequence:CCGGGGGACTTTGATATCGACATTGCTCGAGCAATGTCGATATCAAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000189.4-4365s21c1
Sequence:CCGGTGACGACAGCATCATTGTTAACTCGAGTTAACAATGATGCTGTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000189.4-5921s21c1
Sequence:CCGGCTTAGGGCAGTCAGTAGTATTCTCGAGAATACTACTGACTGCCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000189.4-4188s21c1
Sequence:CCGGCCGTAACATTCTCATCGATTTCTCGAGAAATCGATGAGAATGTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000189.4-2207s21c1
Sequence:CCGGGGGTGAAAGTAACGGACAATGCTCGAGCATTGTCCGTTACTTTCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000189.4-2324s1c1
Sequence:CCGGGCCTGGCTAACTTCATGGATACTCGAGTATCCATGAAGTTAGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-2749s1c1
Sequence:CCGGACTGAGTTTGACCAGGAGATTCTCGAGAATCTCCTGGTCAAACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000189.4-2346s1c1
Sequence:CCGGGCTACAAATCAAAGACAAGAACTCGAGTTCTTGTCTTTGATTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000189.4-3937s1c1
Sequence:CCGGCACTGTGAAGTTGGCCTCATTCTCGAGAATGAGGCCAACTTCACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-4188s1c1
Sequence:CCGGCCGTAACATTCTCATCGATTTCTCGAGAAATCGATGAGAATGTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-4327s1c1
Sequence:CCGGCGAGCCATCCTGCAACACTTACTCGAGTAAGTGTTGCAGGATGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-2933s1c1
Sequence:CCGGCCAAAGACATCTCAGACATTGCTCGAGCAATGTCTGAGATGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000189.4-2334s1c1
Sequence:CCGGCTTCATGGATAAGCTACAAATCTCGAGATTTGTAGCTTATCCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-3336s1c1
Sequence:CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-6738s1c1
Sequence:CCGGGCTTGAAGATTAGGTACTATCCTCGAGGATAGTACCTAATCTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000189.4-2518s1c1
Sequence:CCGGGACTTTGATATCGACATTGTGCTCGAGCACAATGTCGATATCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000189.4-2297s1c1
Sequence:CCGGCCCAGCTGTTTGACCACATTGCTCGAGCAATGTGGTCAAACAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-1983s1c1
Sequence:CCGGGCAGAAGGTTGACCAGTATCTCTCGAGAGATACTGGTCAACCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000189
VALIDATED
HK2 MISSION shRNA Lentiviral Transduction Particles
hexokinase 2
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000189.4-2516s21c1
Sequence:CCGGGGGACTTTGATATCGACATTGCTCGAGCAATGTCGATATCAAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000189.4-4365s21c1
Sequence:CCGGTGACGACAGCATCATTGTTAACTCGAGTTAACAATGATGCTGTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000189.4-5921s21c1
Sequence:CCGGCTTAGGGCAGTCAGTAGTATTCTCGAGAATACTACTGACTGCCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000189.4-4188s21c1
Sequence:CCGGCCGTAACATTCTCATCGATTTCTCGAGAAATCGATGAGAATGTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000189.4-2207s21c1
Sequence:CCGGGGGTGAAAGTAACGGACAATGCTCGAGCATTGTCCGTTACTTTCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000189.4-2324s1c1
Sequence:CCGGGCCTGGCTAACTTCATGGATACTCGAGTATCCATGAAGTTAGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-2749s1c1
Sequence:CCGGACTGAGTTTGACCAGGAGATTCTCGAGAATCTCCTGGTCAAACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000189.4-2346s1c1
Sequence:CCGGGCTACAAATCAAAGACAAGAACTCGAGTTCTTGTCTTTGATTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000189.4-3937s1c1
Sequence:CCGGCACTGTGAAGTTGGCCTCATTCTCGAGAATGAGGCCAACTTCACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-4188s1c1
Sequence:CCGGCCGTAACATTCTCATCGATTTCTCGAGAAATCGATGAGAATGTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-4327s1c1
Sequence:CCGGCGAGCCATCCTGCAACACTTACTCGAGTAAGTGTTGCAGGATGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-2933s1c1
Sequence:CCGGCCAAAGACATCTCAGACATTGCTCGAGCAATGTCTGAGATGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000189.4-2334s1c1
Sequence:CCGGCTTCATGGATAAGCTACAAATCTCGAGATTTGTAGCTTATCCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-3336s1c1
Sequence:CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-6738s1c1
Sequence:CCGGGCTTGAAGATTAGGTACTATCCTCGAGGATAGTACCTAATCTTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000189.4-2518s1c1
Sequence:CCGGGACTTTGATATCGACATTGTGCTCGAGCACAATGTCGATATCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000189.4-2297s1c1
Sequence:CCGGCCCAGCTGTTTGACCACATTGCTCGAGCAATGTGGTCAAACAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_000189.4-1983s1c1
Sequence:CCGGGCAGAAGGTTGACCAGTATCTCTCGAGAGATACTGGTCAACCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks