EMAIL THIS PAGE TO A FRIEND

HLA-B

major histocompatibility complex, class I, B

Synonyms: AS HLAB SPDA1
Species: Human HLA-B(3106)
Gene ID:
Human(3106) Summary: HLA-B belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. Class I molecules play a central role in the immune system by presenting peptides derived from the endoplasmic reticulum lumen. They are expressed in nearly all cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon 1 encodes the leader peptide, exon 2 and 3 encode the alpha1 and alpha2 domains, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region and exons 6 and 7 encode the cytoplasmic tail. Polymorphisms within exon 2 and exon 3 are responsible for the peptide binding specificity of each class one molecule. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. Hundreds of HLA-B alleles have been described. [provided by RefSeq, Jul 2008]
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405937 Anti-HLA-B antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1410631 Anti-HLA-B antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4700632 Monoclonal Anti-HLA Class I antibody produced in mouse clone MEM-81, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700633 Monoclonal Anti-HLA Class I antibody produced in mouse clone MEM-123, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700635 Monoclonal Anti-HLA Class I antibody produced in mouse clone MEM-147, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
H1650 Monoclonal Anti-HLA Class I Antigen antibody produced in mouse clone W6/32, purified immunoglobulin, buffered aqueous solution human, monkey
flow cytometry, immunofluorescence, immunoprecipitation pricing
F5662 Monoclonal Anti-HLA Class I Antigen−FITC antibody produced in mouse clone W6/32, purified immunoglobulin, buffered aqueous solution human, monkey
flow cytometry, immunofluorescence pricing
SAB4700637 Monoclonal Anti-HLA Class I, low endotoxin antibody produced in mouse clone W6/32, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700638 Monoclonal Anti-HLA Class I-Biotin antibody produced in mouse clone W6/32, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700639 Monoclonal Anti-HLA Class I-FITC antibody produced in mouse clone W6/32, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700634 Monoclonal Anti-HLA Class I-PE antibody produced in mouse clone MEM-123, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700636 Monoclonal Anti-HLA Class I-PE antibody produced in mouse clone MEM-147, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700640 Monoclonal Anti-HLA Class I-PE antibody produced in mouse clone W6/32, purified immunoglobulin, buffered aqueous solution human, nonhuman primates, feline, bovine
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005514 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005514 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005514 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005514 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063248 predicted 451
2 SASI_Hs01_00063249 predicted 785
3 SASI_Hs01_00063245 predicted 311
4 SASI_Hs01_00063250 predicted 302
5 SASI_Hs02_00339728 predicted 1482
6 SASI_Hs02_00339729 predicted 1523
7 SASI_Hs01_00063243 predicted 983
8 SASI_Hs01_00063244 predicted 1124
9 SASI_Hs01_00063246 predicted 349
10 SASI_Hs01_00063247 predicted 990
11 SASI_Hs01_00063251 predicted 932
12 SASI_Hs01_00063252 predicted 1467
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005514
HLA-B MISSION shRNA Bacterial Glycerol Stock
major histocompatibility complex, class I, B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005514.5-767s1c1
Sequence:CCGGAGACCAGACCAGCAGGAGATACTCGAGTATCTCCTGCTGGTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005514.5-742s1c1
Sequence:CCGGCAAACTCAGGACACTGAGCTTCTCGAGAAGCTCAGTGTCCTGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005514.5-255s1c1
Sequence:CCGGCCGGAACACACAGATCTACAACTCGAGTTGTAGATCTGTGTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005514.5-1177s1c1
Sequence:CCGGCTTTCTGCAAAGGCACCTGAACTCGAGTTCAGGTGCCTTTGCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005514.5-78s1c1
Sequence:CCGGCCACTCCATGAGGTATTTCTACTCGAGTAGAAATACCTCATGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005514.6-744s21c1
Sequence:CCGGGGGTTTCTACCCTGCGGAGATCTCGAGATCTCCGCAGGGTAGAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005514.6-1351s21c1
Sequence:CCGGCCCAGTCATCTTTCTTGTTCCCTCGAGGGAACAAGAAAGATGACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005514.6-216s21c1
Sequence:CCGGCACCCAGTTCGTGAGGTTCGACTCGAGTCGAACCTCACGAACTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005514
HLA-B MISSION shRNA shRNA Plasmid DNA
major histocompatibility complex, class I, B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005514.5-767s1c1
Sequence:CCGGAGACCAGACCAGCAGGAGATACTCGAGTATCTCCTGCTGGTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005514.5-742s1c1
Sequence:CCGGCAAACTCAGGACACTGAGCTTCTCGAGAAGCTCAGTGTCCTGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005514.5-255s1c1
Sequence:CCGGCCGGAACACACAGATCTACAACTCGAGTTGTAGATCTGTGTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005514.5-1177s1c1
Sequence:CCGGCTTTCTGCAAAGGCACCTGAACTCGAGTTCAGGTGCCTTTGCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005514.5-78s1c1
Sequence:CCGGCCACTCCATGAGGTATTTCTACTCGAGTAGAAATACCTCATGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005514.6-744s21c1
Sequence:CCGGGGGTTTCTACCCTGCGGAGATCTCGAGATCTCCGCAGGGTAGAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005514.6-1351s21c1
Sequence:CCGGCCCAGTCATCTTTCTTGTTCCCTCGAGGGAACAAGAAAGATGACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005514.6-216s21c1
Sequence:CCGGCACCCAGTTCGTGAGGTTCGACTCGAGTCGAACCTCACGAACTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005514
HLA-B MISSION shRNA Lentiviral Transduction Particles
major histocompatibility complex, class I, B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005514.5-767s1c1
Sequence:CCGGAGACCAGACCAGCAGGAGATACTCGAGTATCTCCTGCTGGTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005514.5-742s1c1
Sequence:CCGGCAAACTCAGGACACTGAGCTTCTCGAGAAGCTCAGTGTCCTGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005514.5-255s1c1
Sequence:CCGGCCGGAACACACAGATCTACAACTCGAGTTGTAGATCTGTGTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005514.5-1177s1c1
Sequence:CCGGCTTTCTGCAAAGGCACCTGAACTCGAGTTCAGGTGCCTTTGCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005514.5-78s1c1
Sequence:CCGGCCACTCCATGAGGTATTTCTACTCGAGTAGAAATACCTCATGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005514.6-744s21c1
Sequence:CCGGGGGTTTCTACCCTGCGGAGATCTCGAGATCTCCGCAGGGTAGAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005514.6-1351s21c1
Sequence:CCGGCCCAGTCATCTTTCTTGTTCCCTCGAGGGAACAAGAAAGATGACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005514.6-216s21c1
Sequence:CCGGCACCCAGTTCGTGAGGTTCGACTCGAGTCGAACCTCACGAACTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks