EMAIL THIS PAGE TO A FRIEND

HMGB3P30

high mobility group box 3 pseudogene 30

Species: Human HMGB3P30(203510)
Gene ID:
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001719132 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001719132 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001719132 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001719132 Rosetta Predictions human pricing
XM_001719371 Rosetta Predictions human pricing
XM_001723892 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00428407 predicted 236
2 SASI_Hs02_00428408 predicted 233
3 SASI_Hs02_00428409 predicted 252
4 SASI_Hs02_00428410 predicted 250
5 SASI_Hs02_00428411 predicted 201
6 SASI_Hs02_00428412 predicted 203
7 SASI_Hs02_00428413 predicted 204
8 SASI_Hs02_00428414 predicted 202
9 SASI_Hs02_00428415 predicted 198
10 SASI_Hs02_00428416 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00429910 predicted 237
2 SASI_Hs02_00429911 predicted 229
3 SASI_Hs02_00429912 predicted 257
4 SASI_Hs02_00429913 predicted 255
5 SASI_Hs02_00429914 predicted 199
6 SASI_Hs02_00429915 predicted 205
7 SASI_Hs02_00429916 predicted 199
8 SASI_Hs02_00429917 predicted 202
9 SASI_Hs02_00429918 predicted 200
10 SASI_Hs02_00429919 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00458303 predicted 231
2 SASI_Hs02_00458304 predicted 233
3 SASI_Hs02_00458305 predicted 255
4 SASI_Hs02_00458306 predicted 254
5 SASI_Hs02_00458307 predicted 195
6 SASI_Hs02_00458308 predicted 203
7 SASI_Hs02_00458309 predicted 202
8 SASI_Hs02_00458310 predicted 205
9 SASI_Hs02_00458311 predicted 194
10 SASI_Hs02_00458312 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001719132
HMGB3P30 MISSION shRNA Bacterial Glycerol Stock
high mobility group box 3 pseudogene 30
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001719132.1-188s21c1
Sequence:CCGGTGGCAAAGGTGGATAAAGTACCTCGAGGTACTTTATCCACCTTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001719132.1-223s21c1
Sequence:CCGGATGAAGGATAATGGACCAGTTCTCGAGAACTGGTCCATTATCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001719132.1-427s21c1
Sequence:CCGGACTAAGGCAGCAGACCTGAAGCTCGAGCTTCAGGTCTGCTGCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001719132.1-380s21c1
Sequence:CCGGGTGAGATGTGGATTAACTATACTCGAGTATAGTTAATCCACATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001719132.1-157s21c1
Sequence:CCGGTCTGGGAAAGAGAAGACCAAACTCGAGTTTGGTCTTCTCTTTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001719132
HMGB3P30 MISSION shRNA shRNA Plasmid DNA
high mobility group box 3 pseudogene 30
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001719132.1-188s21c1
Sequence:CCGGTGGCAAAGGTGGATAAAGTACCTCGAGGTACTTTATCCACCTTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001719132.1-223s21c1
Sequence:CCGGATGAAGGATAATGGACCAGTTCTCGAGAACTGGTCCATTATCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001719132.1-427s21c1
Sequence:CCGGACTAAGGCAGCAGACCTGAAGCTCGAGCTTCAGGTCTGCTGCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001719132.1-380s21c1
Sequence:CCGGGTGAGATGTGGATTAACTATACTCGAGTATAGTTAATCCACATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001719132.1-157s21c1
Sequence:CCGGTCTGGGAAAGAGAAGACCAAACTCGAGTTTGGTCTTCTCTTTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001719132
HMGB3P30 MISSION shRNA Lentiviral Transduction Particles
high mobility group box 3 pseudogene 30
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001719132.1-188s21c1
Sequence:CCGGTGGCAAAGGTGGATAAAGTACCTCGAGGTACTTTATCCACCTTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001719132.1-223s21c1
Sequence:CCGGATGAAGGATAATGGACCAGTTCTCGAGAACTGGTCCATTATCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001719132.1-427s21c1
Sequence:CCGGACTAAGGCAGCAGACCTGAAGCTCGAGCTTCAGGTCTGCTGCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001719132.1-380s21c1
Sequence:CCGGGTGAGATGTGGATTAACTATACTCGAGTATAGTTAATCCACATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001719132.1-157s21c1
Sequence:CCGGTCTGGGAAAGAGAAGACCAAACTCGAGTTTGGTCTTCTCTTTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks