EMAIL THIS PAGE TO A FRIEND

HMGN1

high mobility group nucleosome binding domain 1

Synonyms: HMG14
UniProtKB ID: P05114, Q3KQR8
Gene ID:
Human(3150) Summary: The protein encoded by this gene binds nucleosomal DNA and is associated with transcriptionally active chromatin. Along with a similar protein, HMG17, the encoded protein may help maintain an open chromatin configuration around transcribable genes. [provided by RefSeq, Aug 2011]
Mouse(15312) high mobility group nucleosomal binding domain 1
Rat(360704) high mobility group nucleosome binding domain 1
Domestic Rabbit(100328653) high mobility group nucleosome binding domain 1
domestic guinea pig(100725547) high mobility group nucleosome binding domain 1
naked mole-rat(101714016) high mobility group nucleosome binding domain 1
chicken(395999) high mobility group nucleosome binding domain 1
cow(785479) high mobility group nucleosome binding domain 1
cow(614915) high mobility group nucleosome binding domain 1
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008251 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008251 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008251 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004965 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004965 Rosetta Predictions human pricing
NM_001013184 Rosetta Predictions rat pricing
NM_008251 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338654 predicted 276
2 SASI_Hs02_00338655 predicted 390
3 SASI_Hs02_00338656 predicted 270
4 SASI_Hs01_00126867 predicted 944
5 SASI_Hs02_00338657 predicted 882
6 SASI_Hs02_00338658 predicted 391
7 SASI_Hs02_00338659 predicted 314
8 SASI_Hs02_00338660 predicted 441
9 SASI_Hs02_00338661 predicted 956
10 SASI_Hs02_00338662 predicted 813
11 SASI_Hs01_00126865 predicted 1002
12 SASI_Hs01_00126866 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013184 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062233 predicted 814
2 SASI_Rn01_00062234 predicted 862
3 SASI_Rn01_00062240 predicted 259
4 SASI_Rn01_00062236 predicted 768
5 SASI_Rn01_00062238 predicted 192
6 SASI_Rn02_00200943 predicted 319
7 SASI_Rn02_00200944 predicted 365
8 SASI_Rn01_00062239 predicted 665
9 SASI_Rn01_00062241 predicted 622
10 SASI_Rn01_00062242 predicted 76
11 SASI_Rn01_00062235 predicted 207
12 SASI_Rn01_00062237 predicted 169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183620 predicted 406
2 SASI_Mm01_00183621 predicted 744
3 SASI_Mm01_00183622 predicted 246
4 SASI_Mm01_00183623 predicted 199
5 SASI_Mm01_00183624 predicted 664
6 SASI_Mm02_00313446 predicted 427
7 SASI_Mm01_00183625 predicted 743
8 SASI_Mm01_00183626 predicted 534
9 SASI_Mm01_00183627 predicted 302
10 SASI_Mm01_00183628 predicted 715
11 SASI_Mm01_00183629 predicted 760
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008251
HMGN1 MISSION shRNA Bacterial Glycerol Stock
high mobility group nucleosome binding domain 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008251.3-721s21c1
Sequence:CCGGAGTATACTAAATGGCAATTTGCTCGAGCAAATTGCCATTTAGTATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008251.3-780s21c1
Sequence:CCGGTTCTATCTGGTCCCGTGTTTCCTCGAGGAAACACGGGACCAGATAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008251.3-863s21c1
Sequence:CCGGTGTGGTCATGGCAGTCCATTTCTCGAGAAATGGACTGCCATGACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008251.3-391s1c1
Sequence:CCGGGAAAGAAGCTAAGTCCGACTACTCGAGTAGTCGGACTTAGCTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008251.3-382s1c1
Sequence:CCGGTGAAGAAGAGAAAGAAGCTAACTCGAGTTAGCTTCTTTCTCTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008251.3-243s1c1
Sequence:CCGGGAAAGGATAAAGCATCAGACACTCGAGTGTCTGATGCTTTATCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008251.3-239s1c1
Sequence:CCGGGCGGGAAAGGATAAAGCATCACTCGAGTGATGCTTTATCCTTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008251.3-374s1c1
Sequence:CCGGCCAGCCTCTGAAGAAGAGAAACTCGAGTTTCTCTTCTTCAGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008251
HMGN1 MISSION shRNA shRNA Plasmid DNA
high mobility group nucleosome binding domain 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008251.3-721s21c1
Sequence:CCGGAGTATACTAAATGGCAATTTGCTCGAGCAAATTGCCATTTAGTATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008251.3-780s21c1
Sequence:CCGGTTCTATCTGGTCCCGTGTTTCCTCGAGGAAACACGGGACCAGATAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008251.3-863s21c1
Sequence:CCGGTGTGGTCATGGCAGTCCATTTCTCGAGAAATGGACTGCCATGACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008251.3-391s1c1
Sequence:CCGGGAAAGAAGCTAAGTCCGACTACTCGAGTAGTCGGACTTAGCTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008251.3-382s1c1
Sequence:CCGGTGAAGAAGAGAAAGAAGCTAACTCGAGTTAGCTTCTTTCTCTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008251.3-243s1c1
Sequence:CCGGGAAAGGATAAAGCATCAGACACTCGAGTGTCTGATGCTTTATCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008251.3-239s1c1
Sequence:CCGGGCGGGAAAGGATAAAGCATCACTCGAGTGATGCTTTATCCTTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008251.3-374s1c1
Sequence:CCGGCCAGCCTCTGAAGAAGAGAAACTCGAGTTTCTCTTCTTCAGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008251
HMGN1 MISSION shRNA Lentiviral Transduction Particles
high mobility group nucleosome binding domain 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008251.3-721s21c1
Sequence:CCGGAGTATACTAAATGGCAATTTGCTCGAGCAAATTGCCATTTAGTATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008251.3-780s21c1
Sequence:CCGGTTCTATCTGGTCCCGTGTTTCCTCGAGGAAACACGGGACCAGATAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008251.3-863s21c1
Sequence:CCGGTGTGGTCATGGCAGTCCATTTCTCGAGAAATGGACTGCCATGACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008251.3-391s1c1
Sequence:CCGGGAAAGAAGCTAAGTCCGACTACTCGAGTAGTCGGACTTAGCTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008251.3-382s1c1
Sequence:CCGGTGAAGAAGAGAAAGAAGCTAACTCGAGTTAGCTTCTTTCTCTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008251.3-243s1c1
Sequence:CCGGGAAAGGATAAAGCATCAGACACTCGAGTGTCTGATGCTTTATCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008251.3-239s1c1
Sequence:CCGGGCGGGAAAGGATAAAGCATCACTCGAGTGATGCTTTATCCTTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008251.3-374s1c1
Sequence:CCGGCCAGCCTCTGAAGAAGAGAAACTCGAGTTTCTCTTCTTCAGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004965
VALIDATED
HMGN1 MISSION shRNA Bacterial Glycerol Stock
high mobility group nucleosome binding domain 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004965.6-498s21c1
Sequence:CCGGGTCTGATTAATAACCATATACCTCGAGGTATATGGTTATTAATCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004965.6-400s21c1
Sequence:CCGGGCTAACCAAGAAACTAAAGAACTCGAGTTCTTTAGTTTCTTGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004965.6-552s21c1
Sequence:CCGGGTACAATCCAGAGGAATATTTCTCGAGAAATATTCCTCTGGATTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004965.6-327s21c1
Sequence:CCGGGAAGGATAAATCTTCAGACAACTCGAGTTGTCTGAAGATTTATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004965.6-276s21c1
Sequence:CCGGGTCAGCTAAACCTCCTGCAAACTCGAGTTTGCAGGAGGTTTAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004965.6-767s21c1
Sequence:GTACCGGTCGGGTGTCAGCTTAACATTCCTCGAGGAATGTTAAGCTGACACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004965.6-844s21c1
Sequence:GTACCGGATGGAGTCAGTCCTGCATTTACTCGAGTAAATGCAGGACTGACTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004965.4-325s1c1
Sequence:CCGGCCAAGAAACTAAAGAAGACTTCTCGAGAAGTCTTCTTTAGTTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004965.4-388s1c1
Sequence:CCGGCTCTGATGAAGCAGGAGAGAACTCGAGTTCTCTCCTGCTTCATCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004965.4-247s1c1
Sequence:CCGGGAAGGATAAATCTTCAGACAACTCGAGTTGTCTGAAGATTTATCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004965.4-320s1c1
Sequence:CCGGGCTAACCAAGAAACTAAAGAACTCGAGTTCTTTAGTTTCTTGGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004965.4-196s1c1
Sequence:CCGGGTCAGCTAAACCTCCTGCAAACTCGAGTTTGCAGGAGGTTTAGCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004965
VALIDATED
HMGN1 MISSION shRNA shRNA Plasmid DNA
high mobility group nucleosome binding domain 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004965.6-498s21c1
Sequence:CCGGGTCTGATTAATAACCATATACCTCGAGGTATATGGTTATTAATCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004965.6-400s21c1
Sequence:CCGGGCTAACCAAGAAACTAAAGAACTCGAGTTCTTTAGTTTCTTGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004965.6-552s21c1
Sequence:CCGGGTACAATCCAGAGGAATATTTCTCGAGAAATATTCCTCTGGATTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004965.6-327s21c1
Sequence:CCGGGAAGGATAAATCTTCAGACAACTCGAGTTGTCTGAAGATTTATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004965.6-276s21c1
Sequence:CCGGGTCAGCTAAACCTCCTGCAAACTCGAGTTTGCAGGAGGTTTAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004965.6-767s21c1
Sequence:GTACCGGTCGGGTGTCAGCTTAACATTCCTCGAGGAATGTTAAGCTGACACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004965.6-844s21c1
Sequence:GTACCGGATGGAGTCAGTCCTGCATTTACTCGAGTAAATGCAGGACTGACTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004965.4-325s1c1
Sequence:CCGGCCAAGAAACTAAAGAAGACTTCTCGAGAAGTCTTCTTTAGTTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004965.4-388s1c1
Sequence:CCGGCTCTGATGAAGCAGGAGAGAACTCGAGTTCTCTCCTGCTTCATCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004965.4-247s1c1
Sequence:CCGGGAAGGATAAATCTTCAGACAACTCGAGTTGTCTGAAGATTTATCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004965.4-320s1c1
Sequence:CCGGGCTAACCAAGAAACTAAAGAACTCGAGTTCTTTAGTTTCTTGGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004965.4-196s1c1
Sequence:CCGGGTCAGCTAAACCTCCTGCAAACTCGAGTTTGCAGGAGGTTTAGCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004965
VALIDATED
HMGN1 MISSION shRNA Lentiviral Transduction Particles
high mobility group nucleosome binding domain 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004965.6-498s21c1
Sequence:CCGGGTCTGATTAATAACCATATACCTCGAGGTATATGGTTATTAATCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004965.6-400s21c1
Sequence:CCGGGCTAACCAAGAAACTAAAGAACTCGAGTTCTTTAGTTTCTTGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004965.6-552s21c1
Sequence:CCGGGTACAATCCAGAGGAATATTTCTCGAGAAATATTCCTCTGGATTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004965.6-327s21c1
Sequence:CCGGGAAGGATAAATCTTCAGACAACTCGAGTTGTCTGAAGATTTATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004965.6-276s21c1
Sequence:CCGGGTCAGCTAAACCTCCTGCAAACTCGAGTTTGCAGGAGGTTTAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004965.6-767s21c1
Sequence:GTACCGGTCGGGTGTCAGCTTAACATTCCTCGAGGAATGTTAAGCTGACACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004965.6-844s21c1
Sequence:GTACCGGATGGAGTCAGTCCTGCATTTACTCGAGTAAATGCAGGACTGACTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004965.4-325s1c1
Sequence:CCGGCCAAGAAACTAAAGAAGACTTCTCGAGAAGTCTTCTTTAGTTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004965.4-388s1c1
Sequence:CCGGCTCTGATGAAGCAGGAGAGAACTCGAGTTCTCTCCTGCTTCATCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004965.4-247s1c1
Sequence:CCGGGAAGGATAAATCTTCAGACAACTCGAGTTGTCTGAAGATTTATCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004965.4-320s1c1
Sequence:CCGGGCTAACCAAGAAACTAAAGAACTCGAGTTCTTTAGTTTCTTGGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004965.4-196s1c1
Sequence:CCGGGTCAGCTAAACCTCCTGCAAACTCGAGTTTGCAGGAGGTTTAGCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks