EMAIL THIS PAGE TO A FRIEND

HMGN3

high mobility group nucleosomal binding domain 3

Synonyms: PNAS-25 TRIP7
UniProtKB ID: Q15651, B2RD37, Q5HYD3, Q7RTT0, Q969M5, Q9BZT7
Gene ID:
Human(9324) Summary: Thyroid hormone receptors are hormone-dependent transcription factors that regulate expression of a variety of specific target genes. The protein encoded by this gene binds thyroid hormone receptor beta, but only in the presence of thyroid hormone. The encoded protein, a member of the HMGN protein family, is thought to reduce the compactness of the chromatin fiber in nucleosomes, thereby enhancing transcription from chromatin templates. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Mouse(94353) high mobility group nucleosomal binding domain 3
Rat(113990) high mobility group nucleosomal binding domain 3
Zebrafish(492345) high mobility group nucleosomal binding domain 3
chicken(421853) high mobility group nucleosomal binding domain 3
cow(515652) high mobility group nucleosomal binding domain 3
domestic cat(101095980) high mobility group nucleosomal binding domain 3
dog(611307) high mobility group nucleosomal binding domain 3
sheep(101112400) high mobility group nucleosomal binding domain 3
domestic guinea pig(100723034) high mobility group nucleosomal binding domain 3
naked mole-rat(101699904) high mobility group nucleosomal binding domain 3
139 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175074 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175074 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175074 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004242 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004242 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004242 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004242 Rosetta Predictions human pricing
NM_138730 Rosetta Predictions human pricing
NM_001007020 Rosetta Predictions rat pricing
NM_026122 Rosetta Predictions mouse pricing
NM_175074 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092888 predicted 575
2 SASI_Hs01_00092889 predicted 685
3 SASI_Hs01_00092890 predicted 208
4 SASI_Hs01_00092891 predicted 268
5 SASI_Hs01_00092892 predicted 269
6 SASI_Hs01_00092893 predicted 259
7 SASI_Hs01_00092894 predicted 217
8 SASI_Hs01_00092895 predicted 616
9 SASI_Hs01_00092896 predicted 315
10 SASI_Hs01_00092897 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075822 predicted 530
2 SASI_Hs01_00075823 predicted 646
3 SASI_Hs01_00075824 predicted 206
4 SASI_Hs01_00075825 predicted 264
5 SASI_Hs01_00075826 predicted 265
6 SASI_Hs01_00075827 predicted 252
7 SASI_Hs01_00075828 predicted 208
8 SASI_Hs01_00075829 predicted 572
9 SASI_Hs01_00075830 predicted 317
10 SASI_Hs01_00075831 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007020 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044718 predicted 580
2 SASI_Rn01_00044719 predicted 812
3 SASI_Rn02_00198612 predicted 555
4 SASI_Rn01_00044721 predicted 542
5 SASI_Rn02_00198613 predicted 425
6 SASI_Rn02_00198614 predicted 679
7 SASI_Rn01_00044723 predicted 317
8 SASI_Rn01_00044724 predicted 703
9 SASI_Rn01_00044725 predicted 740
10 SASI_Rn01_00044726 predicted 333
11 SASI_Rn01_00044720 predicted 759
12 SASI_Rn01_00044722 predicted 664
13 SASI_Rn01_00044727 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026122 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184966 predicted 580
2 SASI_Mm01_00184967 predicted 554
3 SASI_Mm01_00184968 predicted 394
4 SASI_Mm01_00184969 predicted 322
5 SASI_Mm01_00184970 predicted 302
6 SASI_Mm01_00184971 predicted 562
7 SASI_Mm01_00184972 predicted 309
8 SASI_Mm01_00184973 predicted 404
9 SASI_Mm01_00184974 predicted 410
10 SASI_Mm01_00184975 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137144 predicted 638
2 SASI_Mm01_00137145 predicted 231
3 SASI_Mm02_00345653 predicted 390
4 SASI_Mm01_00137146 predicted 522
5 SASI_Mm01_00137147 predicted 443
6 SASI_Mm01_00137148 predicted 614
7 SASI_Mm01_00137149 predicted 257
8 SASI_Mm01_00137150 predicted 456
9 SASI_Mm02_00345654 predicted 456
10 SASI_Mm01_00137151 predicted 256
11 SASI_Mm01_00137152 predicted 532
12 SASI_Mm01_00137153 predicted 623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175074
VALIDATED
HMGN3 MISSION shRNA Bacterial Glycerol Stock
high mobility group nucleosomal binding domain 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175074.1-650s1c1
Sequence:CCGGCGTGTGAAATGGATTCAGCATCTCGAGATGCTGAATCCATTTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175074.1-326s1c1
Sequence:CCGGCCTGGAACAAAGATTAGCAGACTCGAGTCTGCTAATCTTTGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175074.1-211s1c1
Sequence:CCGGAGATGGAACCAAGCTAACTAACTCGAGTTAGTTAGCTTGGTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175074.1-286s1c1
Sequence:CCGGACCGGAGTCTAAACCAAGAAACTCGAGTTTCTTGGTTTAGACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175074.1-264s1c1
Sequence:CCGGCCGCGAAACCTGTTCCACCAACTCGAGTTGGTGGAACAGGTTTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175074.1-609s21c1
Sequence:CCGGCATCCTCAAGTCACGCAAATACTCGAGTATTTGCGTGACTTGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175074.1-394s21c1
Sequence:CCGGCACAGAGAACTGAATCTATAGCTCGAGCTATAGATTCAGTTCTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175074.1-322s21c1
Sequence:CCGGAGAACCTGGAACAAAGATTAGCTCGAGCTAATCTTTGTTCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175074.1-265s21c1
Sequence:CCGGCGCGAAACCTGTTCCACCAAACTCGAGTTTGGTGGAACAGGTTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175074.1-212s21c1
Sequence:CCGGGATGGAACCAAGCTAACTAAGCTCGAGCTTAGTTAGCTTGGTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175074
VALIDATED
HMGN3 MISSION shRNA shRNA Plasmid DNA
high mobility group nucleosomal binding domain 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175074.1-650s1c1
Sequence:CCGGCGTGTGAAATGGATTCAGCATCTCGAGATGCTGAATCCATTTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175074.1-326s1c1
Sequence:CCGGCCTGGAACAAAGATTAGCAGACTCGAGTCTGCTAATCTTTGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175074.1-211s1c1
Sequence:CCGGAGATGGAACCAAGCTAACTAACTCGAGTTAGTTAGCTTGGTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175074.1-286s1c1
Sequence:CCGGACCGGAGTCTAAACCAAGAAACTCGAGTTTCTTGGTTTAGACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175074.1-264s1c1
Sequence:CCGGCCGCGAAACCTGTTCCACCAACTCGAGTTGGTGGAACAGGTTTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175074.1-609s21c1
Sequence:CCGGCATCCTCAAGTCACGCAAATACTCGAGTATTTGCGTGACTTGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175074.1-394s21c1
Sequence:CCGGCACAGAGAACTGAATCTATAGCTCGAGCTATAGATTCAGTTCTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175074.1-322s21c1
Sequence:CCGGAGAACCTGGAACAAAGATTAGCTCGAGCTAATCTTTGTTCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175074.1-265s21c1
Sequence:CCGGCGCGAAACCTGTTCCACCAAACTCGAGTTTGGTGGAACAGGTTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175074.1-212s21c1
Sequence:CCGGGATGGAACCAAGCTAACTAAGCTCGAGCTTAGTTAGCTTGGTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175074
VALIDATED
HMGN3 MISSION shRNA Lentiviral Transduction Particles
high mobility group nucleosomal binding domain 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175074.1-650s1c1
Sequence:CCGGCGTGTGAAATGGATTCAGCATCTCGAGATGCTGAATCCATTTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175074.1-326s1c1
Sequence:CCGGCCTGGAACAAAGATTAGCAGACTCGAGTCTGCTAATCTTTGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175074.1-211s1c1
Sequence:CCGGAGATGGAACCAAGCTAACTAACTCGAGTTAGTTAGCTTGGTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175074.1-286s1c1
Sequence:CCGGACCGGAGTCTAAACCAAGAAACTCGAGTTTCTTGGTTTAGACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175074.1-264s1c1
Sequence:CCGGCCGCGAAACCTGTTCCACCAACTCGAGTTGGTGGAACAGGTTTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175074.1-609s21c1
Sequence:CCGGCATCCTCAAGTCACGCAAATACTCGAGTATTTGCGTGACTTGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175074.1-394s21c1
Sequence:CCGGCACAGAGAACTGAATCTATAGCTCGAGCTATAGATTCAGTTCTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175074.1-322s21c1
Sequence:CCGGAGAACCTGGAACAAAGATTAGCTCGAGCTAATCTTTGTTCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175074.1-265s21c1
Sequence:CCGGCGCGAAACCTGTTCCACCAAACTCGAGTTTGGTGGAACAGGTTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175074.1-212s21c1
Sequence:CCGGGATGGAACCAAGCTAACTAAGCTCGAGCTTAGTTAGCTTGGTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004242
VALIDATED
HMGN3 MISSION shRNA Bacterial Glycerol Stock
high mobility group nucleosomal binding domain 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004242.2-321s1c1
Sequence:CCGGCTAAGAAAGAACCTGGAGCAACTCGAGTTGCTCCAGGTTCTTTCTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004242.2-257s1c1
Sequence:CCGGTCTGCCAGATTGTCAGCGAAACTCGAGTTTCGCTGACAATCTGGCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004242.2-456s1c1
Sequence:CCGGCTGTAGATAACGAGGGAGAATCTCGAGATTCTCCCTCGTTATCTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004242.2-390s1c1
Sequence:CCGGGAAAGGAAGGTACTGCACCATCTCGAGATGGTGCAGTACCTTCCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004242.2-328s21c1
Sequence:CCGGAGAACCTGGAGCAAAGATTAGCTCGAGCTAATCTTTGCTCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004242.2-457s21c1
Sequence:CCGGTGTAGATAACGAGGGAGAATGCTCGAGCATTCTCCCTCGTTATCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004242.2-713s21c1
Sequence:CCGGGCATTCCATGCACTTGCTTTACTCGAGTAAAGCAAGTGCATGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004242.2-427s21c1
Sequence:CCGGTAAAGCTGAAGAGGCACAGAACTCGAGTTCTGTGCCTCTTCAGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_004242.2-233s21c1
Sequence:CCGGACTAAACAGGAGCCCACAAGACTCGAGTCTTGTGGGCTCCTGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004242.2-257s21c1
Sequence:CCGGTCTGCCAGATTGTCAGCGAAACTCGAGTTTCGCTGACAATCTGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004242.2-350s21c1
Sequence:CCGGAGAGGTGCTAAAGGGAAGAAGCTCGAGCTTCTTCCCTTTAGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004242.2-691s21c1
Sequence:CCGGAGCTGTGTGTAAGATTGATTCCTCGAGGAATCAATCTTACACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004242
VALIDATED
HMGN3 MISSION shRNA shRNA Plasmid DNA
high mobility group nucleosomal binding domain 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004242.2-321s1c1
Sequence:CCGGCTAAGAAAGAACCTGGAGCAACTCGAGTTGCTCCAGGTTCTTTCTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004242.2-257s1c1
Sequence:CCGGTCTGCCAGATTGTCAGCGAAACTCGAGTTTCGCTGACAATCTGGCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004242.2-456s1c1
Sequence:CCGGCTGTAGATAACGAGGGAGAATCTCGAGATTCTCCCTCGTTATCTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004242.2-390s1c1
Sequence:CCGGGAAAGGAAGGTACTGCACCATCTCGAGATGGTGCAGTACCTTCCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004242.2-328s21c1
Sequence:CCGGAGAACCTGGAGCAAAGATTAGCTCGAGCTAATCTTTGCTCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004242.2-457s21c1
Sequence:CCGGTGTAGATAACGAGGGAGAATGCTCGAGCATTCTCCCTCGTTATCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004242.2-713s21c1
Sequence:CCGGGCATTCCATGCACTTGCTTTACTCGAGTAAAGCAAGTGCATGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004242.2-427s21c1
Sequence:CCGGTAAAGCTGAAGAGGCACAGAACTCGAGTTCTGTGCCTCTTCAGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_004242.2-233s21c1
Sequence:CCGGACTAAACAGGAGCCCACAAGACTCGAGTCTTGTGGGCTCCTGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004242.2-257s21c1
Sequence:CCGGTCTGCCAGATTGTCAGCGAAACTCGAGTTTCGCTGACAATCTGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004242.2-350s21c1
Sequence:CCGGAGAGGTGCTAAAGGGAAGAAGCTCGAGCTTCTTCCCTTTAGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004242.2-691s21c1
Sequence:CCGGAGCTGTGTGTAAGATTGATTCCTCGAGGAATCAATCTTACACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004242
VALIDATED
HMGN3 MISSION shRNA Lentiviral Transduction Particles
high mobility group nucleosomal binding domain 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004242.2-321s1c1
Sequence:CCGGCTAAGAAAGAACCTGGAGCAACTCGAGTTGCTCCAGGTTCTTTCTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004242.2-257s1c1
Sequence:CCGGTCTGCCAGATTGTCAGCGAAACTCGAGTTTCGCTGACAATCTGGCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004242.2-456s1c1
Sequence:CCGGCTGTAGATAACGAGGGAGAATCTCGAGATTCTCCCTCGTTATCTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004242.2-390s1c1
Sequence:CCGGGAAAGGAAGGTACTGCACCATCTCGAGATGGTGCAGTACCTTCCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004242.2-328s21c1
Sequence:CCGGAGAACCTGGAGCAAAGATTAGCTCGAGCTAATCTTTGCTCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004242.2-457s21c1
Sequence:CCGGTGTAGATAACGAGGGAGAATGCTCGAGCATTCTCCCTCGTTATCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004242.2-713s21c1
Sequence:CCGGGCATTCCATGCACTTGCTTTACTCGAGTAAAGCAAGTGCATGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004242.2-427s21c1
Sequence:CCGGTAAAGCTGAAGAGGCACAGAACTCGAGTTCTGTGCCTCTTCAGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_004242.2-233s21c1
Sequence:CCGGACTAAACAGGAGCCCACAAGACTCGAGTCTTGTGGGCTCCTGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004242.2-257s21c1
Sequence:CCGGTCTGCCAGATTGTCAGCGAAACTCGAGTTTCGCTGACAATCTGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004242.2-350s21c1
Sequence:CCGGAGAGGTGCTAAAGGGAAGAAGCTCGAGCTTCTTCCCTTTAGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004242.2-691s21c1
Sequence:CCGGAGCTGTGTGTAAGATTGATTCCTCGAGGAATCAATCTTACACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks