EMAIL THIS PAGE TO A FRIEND

HMHB1

histocompatibility (minor) HB-1

Synonyms: HB-1 HLA-HB1
Species: Human HMHB1(57824)
UniProtKB ID: O97980, Q9MY25
Gene ID:
Human(57824) Summary: This gene encodes one of the minor histocompatibility antigens, which play an important role in the induction of cytotoxic T lymphocyte (CTL) reactivity against leukemia after human histocompatibility leukocyte antigen (HLA)-identical allogeneic bone marrow transplantation (BMT). This gene is only expressed in B cell acute lymphoblastic leukemia cells and Epstein-Barr virus-transformed B cells. The translation of this mRNA initiates at a non-AUG (CUG) codon. [provided by RefSeq, Jul 2008]
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021182 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021182 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021182 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058711 MISSION® esiRNA esiRNA human HMHB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021182 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354751 predicted 341
2 SASI_Hs01_00080455 predicted 156
3 SASI_Hs01_00080456 predicted 158
4 SASI_Hs01_00080457 predicted 229
5 SASI_Hs01_00080458 predicted 220
6 SASI_Hs01_00080459 predicted 346
7 SASI_Hs01_00080460 predicted 203
8 SASI_Hs01_00080461 predicted 231
9 SASI_Hs01_00080462 predicted 276
10 SASI_Hs01_00080463 predicted 338
11 SASI_Hs01_00080464 predicted 191
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021182
HMHB1 MISSION shRNA Bacterial Glycerol Stock
histocompatibility (minor) HB-1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021182.1-150s1c1
Sequence:CCGGCTGCATGTTTGGAAGTCGGAACTCGAGTTCCGACTTCCAAACATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021182.1-180s1c1
Sequence:CCGGGTTGAAGATGATGTGTATCTGCTCGAGCAGATACACATCATCTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021182.1-153s1c1
Sequence:CCGGCATGTTTGGAAGTCGGAATTGCTCGAGCAATTCCGACTTCCAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021182.1-168s1c1
Sequence:CCGGGAATTGGTTGAAGTTGAAGATCTCGAGATCTTCAACTTCAACCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021182.1-161s1c1
Sequence:CCGGGAAGTCGGAATTGGTTGAAGTCTCGAGACTTCAACCAATTCCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021182.1-156s1c1
Sequence:CCGGGTTTGGAAGTCGGAATTGGTTCTCGAGAACCAATTCCGACTTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021182.1-226s21c1
Sequence:CCGGGGCTTTGACACTGCTGTTGAGCTCGAGCTCAACAGCAGTGTCAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021182
HMHB1 MISSION shRNA shRNA Plasmid DNA
histocompatibility (minor) HB-1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021182.1-150s1c1
Sequence:CCGGCTGCATGTTTGGAAGTCGGAACTCGAGTTCCGACTTCCAAACATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021182.1-180s1c1
Sequence:CCGGGTTGAAGATGATGTGTATCTGCTCGAGCAGATACACATCATCTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021182.1-153s1c1
Sequence:CCGGCATGTTTGGAAGTCGGAATTGCTCGAGCAATTCCGACTTCCAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021182.1-168s1c1
Sequence:CCGGGAATTGGTTGAAGTTGAAGATCTCGAGATCTTCAACTTCAACCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021182.1-161s1c1
Sequence:CCGGGAAGTCGGAATTGGTTGAAGTCTCGAGACTTCAACCAATTCCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021182.1-156s1c1
Sequence:CCGGGTTTGGAAGTCGGAATTGGTTCTCGAGAACCAATTCCGACTTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021182.1-226s21c1
Sequence:CCGGGGCTTTGACACTGCTGTTGAGCTCGAGCTCAACAGCAGTGTCAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021182
HMHB1 MISSION shRNA Lentiviral Transduction Particles
histocompatibility (minor) HB-1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021182.1-150s1c1
Sequence:CCGGCTGCATGTTTGGAAGTCGGAACTCGAGTTCCGACTTCCAAACATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021182.1-180s1c1
Sequence:CCGGGTTGAAGATGATGTGTATCTGCTCGAGCAGATACACATCATCTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021182.1-153s1c1
Sequence:CCGGCATGTTTGGAAGTCGGAATTGCTCGAGCAATTCCGACTTCCAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021182.1-168s1c1
Sequence:CCGGGAATTGGTTGAAGTTGAAGATCTCGAGATCTTCAACTTCAACCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021182.1-161s1c1
Sequence:CCGGGAAGTCGGAATTGGTTGAAGTCTCGAGACTTCAACCAATTCCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021182.1-156s1c1
Sequence:CCGGGTTTGGAAGTCGGAATTGGTTCTCGAGAACCAATTCCGACTTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021182.1-226s21c1
Sequence:CCGGGGCTTTGACACTGCTGTTGAGCTCGAGCTCAACAGCAGTGTCAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks