EMAIL THIS PAGE TO A FRIEND

HMX2

H6 family homeobox 2

Synonyms: H6L Nkx5-2
UniProtKB ID: A2RU54, B2RNV5
Gene ID:
Human(3167) Summary: The protein encoded by this gene is a member of the NKL homeobox family of transcription factors. Members in this family are of ancient origin and play an important role in organ development during embryogenesis. A related mouse protein plays a role in patterning of inner ear structures. In humans, variations in a region containing this gene have been associated with inner ear malformations, vestibular dysfunction, and hearing loss. [provided by RefSeq, Aug 2012]
Mouse(15372) H6 homeobox 2
Rat(293538) H6 family homeobox 2
domestic guinea pig(100736083) H6 family homeobox 2
naked mole-rat(101698160) H6 family homeobox 2
sheep(101103109) H6 family homeobox 2
Zebrafish(555632) H6 family homeobox 2
cow(525631) H6 family homeobox 2
domestic cat(101093050) H6 family homeobox 2
dog(486925) H6 family homeobox 2
chicken(768405) H6 family homeobox 2
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005519 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005519 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005519 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145998 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145998 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145998 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005519 Rosetta Predictions human pricing
NM_001106303 Rosetta Predictions rat pricing
NM_145998 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070682 predicted 587
2 SASI_Hs02_00339735 predicted 588
3 SASI_Hs01_00070683 predicted 809
4 SASI_Hs01_00070684 predicted 587
5 SASI_Hs01_00070685 predicted 552
6 SASI_Hs01_00070686 predicted 816
7 SASI_Hs01_00070687 predicted 587
8 SASI_Hs01_00070688 predicted 442
9 SASI_Hs01_00070690 predicted 816
10 SASI_Hs01_00070691 predicted 831
11 SASI_Hs01_00070689 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106303 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217648 predicted 657
2 SASI_Rn02_00217649 predicted 592
3 SASI_Rn02_00217650 predicted 825
4 SASI_Rn02_00217651 predicted 428
5 SASI_Rn02_00217652 predicted 753
6 SASI_Rn02_00217653 predicted 338
7 SASI_Rn02_00217654 predicted 223
8 SASI_Rn02_00217655 predicted 770
9 SASI_Rn02_00217656 predicted 853
10 SASI_Rn02_00217657 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145998 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063812 predicted 571
2 SASI_Mm02_00341533 predicted 1011
3 SASI_Mm01_00063813 predicted 572
4 SASI_Mm01_00063814 predicted 871
5 SASI_Mm01_00063815 predicted 931
6 SASI_Mm01_00063816 predicted 664
7 SASI_Mm01_00063817 predicted 413
8 SASI_Mm01_00063818 predicted 665
9 SASI_Mm01_00063819 predicted 720
10 SASI_Mm01_00063820 predicted 406
11 SASI_Mm01_00063821 predicted 789
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005519
HMX2 MISSION shRNA Bacterial Glycerol Stock
H6 family homeobox 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000180291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005519.1-588s1c1
Sequence:CCGGCCTTCGCACTCGGACTTTAAACTCGAGTTTAAAGTCCGAGTGCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005519.1-593s1c1
Sequence:CCGGGCACTCGGACTTTAAAGAAGACTCGAGTCTTCTTTAAAGTCCGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147277    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005519.1-1163s1c1
Sequence:CCGGGCGTGTTTCCAGAAATATGAACTCGAGTTCATATTTCTGGAAACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005519.1-596s1c1
Sequence:CCGGCTCGGACTTTAAAGAAGAGAACTCGAGTTCTCTTCTTTAAAGTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005519
HMX2 MISSION shRNA shRNA Plasmid DNA
H6 family homeobox 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000180291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005519.1-588s1c1
Sequence:CCGGCCTTCGCACTCGGACTTTAAACTCGAGTTTAAAGTCCGAGTGCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005519.1-593s1c1
Sequence:CCGGGCACTCGGACTTTAAAGAAGACTCGAGTCTTCTTTAAAGTCCGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147277    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005519.1-1163s1c1
Sequence:CCGGGCGTGTTTCCAGAAATATGAACTCGAGTTCATATTTCTGGAAACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005519.1-596s1c1
Sequence:CCGGCTCGGACTTTAAAGAAGAGAACTCGAGTTCTCTTCTTTAAAGTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005519
HMX2 MISSION shRNA Lentiviral Transduction Particles
H6 family homeobox 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000180291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005519.1-588s1c1
Sequence:CCGGCCTTCGCACTCGGACTTTAAACTCGAGTTTAAAGTCCGAGTGCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005519.1-593s1c1
Sequence:CCGGGCACTCGGACTTTAAAGAAGACTCGAGTCTTCTTTAAAGTCCGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147277    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005519.1-1163s1c1
Sequence:CCGGGCGTGTTTCCAGAAATATGAACTCGAGTTCATATTTCTGGAAACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005519.1-596s1c1
Sequence:CCGGCTCGGACTTTAAAGAAGAGAACTCGAGTTCTCTTCTTTAAAGTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145998
HMX2 MISSION shRNA Bacterial Glycerol Stock
H6 family homeobox 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145998.1-454s1c1
Sequence:CCGGCCCGGACTTTAAGGAAGAGAACTCGAGTTCTCTTCCTTAAAGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145998.1-688s1c1
Sequence:CCGGCCAGGTTAAGACTTGGTTCCACTCGAGTGGAACCAAGTCTTAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145998.1-868s1c1
Sequence:CCGGGCTTTATTACCCGAGCAGCAACTCGAGTTGCTGCTCGGGTAATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145998.1-913s1c1
Sequence:CCGGCCTGTACAACAAGCTTGACTACTCGAGTAGTCAAGCTTGTTGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145998.1-801s1c1
Sequence:CCGGCGCTCGTGTTTCGGGACAGTTCTCGAGAACTGTCCCGAAACACGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145998
HMX2 MISSION shRNA shRNA Plasmid DNA
H6 family homeobox 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145998.1-454s1c1
Sequence:CCGGCCCGGACTTTAAGGAAGAGAACTCGAGTTCTCTTCCTTAAAGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145998.1-688s1c1
Sequence:CCGGCCAGGTTAAGACTTGGTTCCACTCGAGTGGAACCAAGTCTTAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145998.1-868s1c1
Sequence:CCGGGCTTTATTACCCGAGCAGCAACTCGAGTTGCTGCTCGGGTAATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145998.1-913s1c1
Sequence:CCGGCCTGTACAACAAGCTTGACTACTCGAGTAGTCAAGCTTGTTGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145998.1-801s1c1
Sequence:CCGGCGCTCGTGTTTCGGGACAGTTCTCGAGAACTGTCCCGAAACACGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145998
HMX2 MISSION shRNA Lentiviral Transduction Particles
H6 family homeobox 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145998.1-454s1c1
Sequence:CCGGCCCGGACTTTAAGGAAGAGAACTCGAGTTCTCTTCCTTAAAGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145998.1-688s1c1
Sequence:CCGGCCAGGTTAAGACTTGGTTCCACTCGAGTGGAACCAAGTCTTAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145998.1-868s1c1
Sequence:CCGGGCTTTATTACCCGAGCAGCAACTCGAGTTGCTGCTCGGGTAATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145998.1-913s1c1
Sequence:CCGGCCTGTACAACAAGCTTGACTACTCGAGTAGTCAAGCTTGTTGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145998.1-801s1c1
Sequence:CCGGCGCTCGTGTTTCGGGACAGTTCTCGAGAACTGTCCCGAAACACGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks