EMAIL THIS PAGE TO A FRIEND

HNMT

histamine N-methyltransferase

Synonyms: HMT HNMT-S1 HNMT-S2
Gene ID:
Human(3176) Summary: In mammals, histamine is metabolized by two major pathways: N(tau)-methylation via histamine N-methyltransferase and oxidative deamination via diamine oxidase. This gene encodes the first enzyme which is found in the cytosol and uses S-adenosyl-L-methionine as the methyl donor. In the mammalian brain, the neurotransmitter activity of histamine is controlled by N(tau)-methylation as diamine oxidase is not found in the central nervous system. A common genetic polymorphism affects the activity levels of this gene product in red blood cells. Multiple alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(140483) histamine N-methyltransferase
Rat(81676) histamine N-methyltransferase
sheep(101102876) histamine N-methyltransferase
sheep(641310) histamine N-methyltransferase
domestic guinea pig(100135537) histamine N-methyltransferase
Zebrafish(445242) histamine N-methyltransferase
dog(476133) histamine N-methyltransferase
cow(613413) histamine N-methyltransferase
domestic cat(101093704) histamine N-methyltransferase
chicken(424298) histamine N-methyltransferase
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006895 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006895 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006895 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080462 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080462 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080462 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024074 Rosetta Predictions human pricing
NM_001024075 Rosetta Predictions human pricing
NM_006895 Rosetta Predictions human pricing
NM_031044 Rosetta Predictions rat pricing
NM_080462 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204708 predicted 371
2 SASI_Hs02_00307110 predicted 255
3 SASI_Hs01_00204709 predicted 308
4 SASI_Hs01_00204710 predicted 285
5 SASI_Hs01_00204711 predicted 305
6 SASI_Hs01_00204712 predicted 373
7 SASI_Hs01_00204713 predicted 282
8 SASI_Hs01_00204714 predicted 381
9 SASI_Hs01_00204715 predicted 279
10 SASI_Hs01_00204716 predicted 302
11 SASI_Hs01_00204717 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062195 predicted 371
2 SASI_Hs01_00062196 predicted 385
3 SASI_Hs01_00062197 predicted 368
4 SASI_Hs01_00062198 predicted 386
5 SASI_Hs01_00062199 predicted 365
6 SASI_Hs01_00062200 predicted 349
7 SASI_Hs01_00062201 predicted 376
8 SASI_Hs02_00307111 predicted 360
9 SASI_Hs02_00307112 predicted 356
10 SASI_Hs01_00062202 predicted 380
11 SASI_Hs01_00062203 predicted 553
12 SASI_Hs01_00062204 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129576 predicted 732
2 SASI_Hs01_00129577 predicted 620
3 SASI_Hs01_00129578 predicted 386
4 SASI_Hs02_00342572 predicted 660
5 SASI_Hs01_00129579 predicted 476
6 SASI_Hs01_00129580 predicted 505
7 SASI_Hs01_00129581 predicted 463
8 SASI_Hs01_00129582 predicted 521
9 SASI_Hs01_00129583 predicted 667
10 SASI_Hs01_00129585 predicted 1114
11 SASI_Hs01_00129584 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031044 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114509 predicted 646
2 SASI_Rn01_00114510 predicted 674
3 SASI_Rn01_00114511 predicted 642
4 SASI_Rn01_00114513 predicted 251
5 SASI_Rn01_00114516 predicted 454
6 SASI_Rn01_00114517 predicted 981
7 SASI_Rn01_00114518 predicted 894
8 SASI_Rn02_00264267 predicted 602
9 SASI_Rn02_00264268 predicted 509
10 SASI_Rn02_00264269 predicted 421
11 SASI_Rn01_00114512 predicted 235
12 SASI_Rn01_00114514 predicted 1132
13 SASI_Rn01_00114515 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147722 predicted 516
2 SASI_Mm01_00147723 predicted 341
3 SASI_Mm01_00147724 predicted 796
4 SASI_Mm01_00147725 predicted 320
5 SASI_Mm01_00147726 predicted 296
6 SASI_Mm01_00147727 predicted 705
7 SASI_Mm01_00147728 predicted 501
8 SASI_Mm01_00147729 predicted 938
9 SASI_Mm01_00147730 predicted 307
10 SASI_Mm01_00147731 predicted 706
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006895
HNMT MISSION shRNA Bacterial Glycerol Stock
histamine N-methyltransferase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006895.2-746s21c1
Sequence:CCGGCAATGCTAAGATGCTCATTATCTCGAGATAATGAGCATCTTAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006895.2-1207s21c1
Sequence:CCGGATCACAAACTCATCCATTAATCTCGAGATTAATGGATGAGTTTGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006895.2-876s21c1
Sequence:CCGGCTGGACAACCTAGGGCTTAAGCTCGAGCTTAAGCCCTAGGTTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006895.2-1118s21c1
Sequence:CCGGAGTGATTGAGGCATAACTATCCTCGAGGATAGTTATGCCTCAATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006895.1-373s1c1
Sequence:CCGGCCAGGCATAATAGGAAGGATTCTCGAGAATCCTTCCTATTATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006895.1-486s1c1
Sequence:CCGGCCCAGGAGTTTGTATCAACAACTCGAGTTGTTGATACAAACTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006895.1-288s1c1
Sequence:CCGGCGGGAAATATGTTGAATCTTTCTCGAGAAAGATTCAACATATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006895.1-934s1c1
Sequence:CCGGGACTGCTTTATTGATGGTAATCTCGAGATTACCATCAATAAAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006895.1-1056s1c1
Sequence:CCGGGCCTGAATTTAGTGCTAAGAACTCGAGTTCTTAGCACTAAATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006895
HNMT MISSION shRNA shRNA Plasmid DNA
histamine N-methyltransferase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006895.2-746s21c1
Sequence:CCGGCAATGCTAAGATGCTCATTATCTCGAGATAATGAGCATCTTAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006895.2-1207s21c1
Sequence:CCGGATCACAAACTCATCCATTAATCTCGAGATTAATGGATGAGTTTGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006895.2-876s21c1
Sequence:CCGGCTGGACAACCTAGGGCTTAAGCTCGAGCTTAAGCCCTAGGTTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006895.2-1118s21c1
Sequence:CCGGAGTGATTGAGGCATAACTATCCTCGAGGATAGTTATGCCTCAATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006895.1-373s1c1
Sequence:CCGGCCAGGCATAATAGGAAGGATTCTCGAGAATCCTTCCTATTATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006895.1-486s1c1
Sequence:CCGGCCCAGGAGTTTGTATCAACAACTCGAGTTGTTGATACAAACTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006895.1-288s1c1
Sequence:CCGGCGGGAAATATGTTGAATCTTTCTCGAGAAAGATTCAACATATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006895.1-934s1c1
Sequence:CCGGGACTGCTTTATTGATGGTAATCTCGAGATTACCATCAATAAAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006895.1-1056s1c1
Sequence:CCGGGCCTGAATTTAGTGCTAAGAACTCGAGTTCTTAGCACTAAATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006895
HNMT MISSION shRNA Lentiviral Transduction Particles
histamine N-methyltransferase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006895.2-746s21c1
Sequence:CCGGCAATGCTAAGATGCTCATTATCTCGAGATAATGAGCATCTTAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006895.2-1207s21c1
Sequence:CCGGATCACAAACTCATCCATTAATCTCGAGATTAATGGATGAGTTTGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006895.2-876s21c1
Sequence:CCGGCTGGACAACCTAGGGCTTAAGCTCGAGCTTAAGCCCTAGGTTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006895.2-1118s21c1
Sequence:CCGGAGTGATTGAGGCATAACTATCCTCGAGGATAGTTATGCCTCAATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006895.1-373s1c1
Sequence:CCGGCCAGGCATAATAGGAAGGATTCTCGAGAATCCTTCCTATTATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006895.1-486s1c1
Sequence:CCGGCCCAGGAGTTTGTATCAACAACTCGAGTTGTTGATACAAACTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006895.1-288s1c1
Sequence:CCGGCGGGAAATATGTTGAATCTTTCTCGAGAAAGATTCAACATATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006895.1-934s1c1
Sequence:CCGGGACTGCTTTATTGATGGTAATCTCGAGATTACCATCAATAAAGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006895.1-1056s1c1
Sequence:CCGGGCCTGAATTTAGTGCTAAGAACTCGAGTTCTTAGCACTAAATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080462
HNMT MISSION shRNA Bacterial Glycerol Stock
histamine N-methyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080462.1-1463s1c1
Sequence:CCGGGCCGATGTTCAGTGTGGAATACTCGAGTATTCCACACTGAACATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080462.1-739s1c1
Sequence:CCGGCCATGGACATAACAGACTGTTCTCGAGAACAGTCTGTTATGTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080462.1-302s1c1
Sequence:CCGGCCCAGGAATCTGTATTAACAACTCGAGTTGTTAATACAGATTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080462.1-875s1c1
Sequence:CCGGGCCTGAATTTAGTGTTAAGAACTCGAGTTCTTAACACTAAATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080462.1-189s1c1
Sequence:CCGGCCGGGCATAATAGCAAGGATTCTCGAGAATCCTTGCTATTATGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080462
HNMT MISSION shRNA shRNA Plasmid DNA
histamine N-methyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080462.1-1463s1c1
Sequence:CCGGGCCGATGTTCAGTGTGGAATACTCGAGTATTCCACACTGAACATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080462.1-739s1c1
Sequence:CCGGCCATGGACATAACAGACTGTTCTCGAGAACAGTCTGTTATGTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080462.1-302s1c1
Sequence:CCGGCCCAGGAATCTGTATTAACAACTCGAGTTGTTAATACAGATTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080462.1-875s1c1
Sequence:CCGGGCCTGAATTTAGTGTTAAGAACTCGAGTTCTTAACACTAAATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080462.1-189s1c1
Sequence:CCGGCCGGGCATAATAGCAAGGATTCTCGAGAATCCTTGCTATTATGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080462
HNMT MISSION shRNA Lentiviral Transduction Particles
histamine N-methyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080462.1-1463s1c1
Sequence:CCGGGCCGATGTTCAGTGTGGAATACTCGAGTATTCCACACTGAACATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080462.1-739s1c1
Sequence:CCGGCCATGGACATAACAGACTGTTCTCGAGAACAGTCTGTTATGTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080462.1-302s1c1
Sequence:CCGGCCCAGGAATCTGTATTAACAACTCGAGTTGTTAATACAGATTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080462.1-875s1c1
Sequence:CCGGGCCTGAATTTAGTGTTAAGAACTCGAGTTCTTAACACTAAATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080462.1-189s1c1
Sequence:CCGGCCGGGCATAATAGCAAGGATTCTCGAGAATCCTTGCTATTATGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks