EMAIL THIS PAGE TO A FRIEND

HNRNPA2B1

heterogeneous nuclear ribonucleoprotein A2/B1

Synonyms: HNRNPA2 HNRNPB1 HNRPA2 HNRPA2B1 HNRPB1 RNPA2 SNRPB1
UniProtKB ID: P22626, A8K064, P22627, Q9UC98, Q9UDJ2
Gene ID:
Human(3181) Summary: This gene belongs to the A/B subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. This gene has been described to generate two alternatively spliced transcript variants which encode different isoforms. [provided by RefSeq, Jul 2008]
Mouse(53379) heterogeneous nuclear ribonucleoprotein A2/B1
Rat(362361) heterogeneous nuclear ribonucleoprotein A2/B1
chicken(420627) heterogeneous nuclear ribonucleoprotein A2/B1
domestic cat(101098942) heterogeneous nuclear ribonucleoprotein A2/B1
Horse(100068539) heterogeneous nuclear ribonucleoprotein A2/B1
dog(475260) heterogeneous nuclear ribonucleoprotein A2/B1
cow(507564) heterogeneous nuclear ribonucleoprotein A2/B1
sheep(101107187) heterogeneous nuclear ribonucleoprotein A2/B1
domestic guinea pig(100715127) heterogeneous nuclear ribonucleoprotein A2/B1
naked mole-rat(101715990) heterogeneous nuclear ribonucleoprotein A2/B1
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501417 Anti-HNRNP A2, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
pricing
AV41035 Anti-HNRNPA2B1 antibody produced in rabbit affinity isolated antibody horse, rabbit, canine, human, mouse, rat
western blot pricing
HPA001666 Anti-HNRNPA2B1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunohistochemistry, western blot pricing
HPA005812 Anti-HNRNPA2B1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
HPA065537 Anti-HNRNPA2B1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
R4653 Monoclonal Anti-hnRNP-A2/B1 antibody produced in mouse clone DP3B3, purified from hybridoma cell culture mouse, human, chicken, canine, rat, monkey, bovine, hamster
immunocytochemistry, immunoprecipitation, microarray, western blot pricing
SAB1403931 Monoclonal Anti-HNRNPA2B1 antibody produced in mouse clone 3G11-6A7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
WH0003181M1 Monoclonal Anti-HNRPA2B1 antibody produced in mouse clone 1G12-6C5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002137 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002137 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002137 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182650 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182650 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182650 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093501 MISSION® esiRNA esiRNA human HNRPA2B1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002137 Rosetta Predictions human pricing
NM_031243 Rosetta Predictions human pricing
NM_001104613 Rosetta Predictions rat pricing
NM_016806 Rosetta Predictions mouse pricing
NM_182650 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122348 predicted 495
2 SASI_Hs01_00122349 predicted 609
3 SASI_Hs01_00122350 predicted 1160
4 SASI_Hs01_00122352 predicted 512
5 SASI_Hs01_00122353 predicted 1104
6 SASI_Hs01_00122354 predicted 758
7 SASI_Hs01_00122355 predicted 1051
8 SASI_Hs01_00122356 predicted 679
9 SASI_Hs01_00122357 predicted 705
10 SASI_Hs02_00333308 predicted 1237
11 SASI_Hs01_00122351 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181131 predicted 534
2 SASI_Hs01_00181132 predicted 649
3 SASI_Hs01_00181133 predicted 1200
4 SASI_Hs01_00181135 predicted 545
5 SASI_Hs01_00181136 predicted 1138
6 SASI_Hs01_00181137 predicted 797
7 SASI_Hs01_00181138 predicted 1085
8 SASI_Hs01_00181139 predicted 717
9 SASI_Hs01_00181140 predicted 742
10 SASI_Hs02_00358644 predicted 1270
11 SASI_Hs01_00181134 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104613 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211676 predicted 770
2 SASI_Rn02_00211677 predicted 763
3 SASI_Rn02_00211678 predicted 655
4 SASI_Rn02_00211679 predicted 742
5 SASI_Rn02_00211680 predicted 765
6 SASI_Rn02_00211681 predicted 804
7 SASI_Rn02_00211682 predicted 808
8 SASI_Rn02_00211683 predicted 746
9 SASI_Rn02_00211684 predicted 810
10 SASI_Rn02_00211685 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200165 predicted 260
2 SASI_Mm01_00200167 predicted 556
3 SASI_Mm02_00323596 predicted 511
4 SASI_Mm01_00200168 predicted 549
5 SASI_Mm01_00200169 predicted 232
6 SASI_Mm01_00200170 predicted 314
7 SASI_Mm01_00200171 predicted 599
8 SASI_Mm01_00200172 predicted 367
9 SASI_Mm01_00200173 predicted 702
10 SASI_Mm01_00200174 predicted 666
11 SASI_Mm01_00200166 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182650 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032343 predicted 552
2 SASI_Mm01_00032344 predicted 232
3 SASI_Mm01_00032345 predicted 244
4 SASI_Mm01_00032346 predicted 596
5 SASI_Mm01_00032347 predicted 363
6 SASI_Mm01_00032348 predicted 701
7 SASI_Mm01_00032349 predicted 708
8 SASI_Mm01_00032350 predicted 470
9 SASI_Mm01_00032352 predicted 403
10 SASI_Mm02_00349951 predicted 705
11 SASI_Mm01_00032351 predicted 274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002137
VALIDATED
HNRNPA2B1 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein A2/B1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002137.3-782s21c1
Sequence:CCGGGTGGAAGAGGAGGCAACTTTGCTCGAGCAAAGTTGCCTCCTCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002137.3-594s21c1
Sequence:CCGGTGATACCATTGAGATAATTACCTCGAGGTAATTATCTCAATGGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002137.3-1312s21c1
Sequence:CCGGAGCTTCAGGTTATCGAAATAACTCGAGTTATTTCGATAACCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002137.3-880s21c1
Sequence:CCGGTATGGCAGTGGACGTGGATTTCTCGAGAAATCCACGTCCACTGCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002137.3-694s21c1
Sequence:CCGGCAGAAATACCATACCATCAATCTCGAGATTGATGGTATGGTATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002137.3-1642s21c1
Sequence:CCGGAGCCAGGATCATGGTGTAATACTCGAGTATTACACCATGATCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002137.x-468s1c1
Sequence:CCGGAGAAGCTGTTTGTTGGCGGAACTCGAGTTCCGCCAACAAACAGCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002137.x-994s1c1
Sequence:CCGGTGACAACTATGGAGGAGGAAACTCGAGTTTCCTCCTCCATAGTTGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002137.x-701s1c1
Sequence:CCGGAGACAAGAAATGCAGGAAGTTCTCGAGAACTTCCTGCATTTCTTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002137.x-647s1c1
Sequence:CCGGCAGAAATACCATACCATCAATCTCGAGATTGATGGTATGGTATTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002137.x-1196s1c1
Sequence:CCGGGCTTCTTCCTATTTGCCATGGCTCGAGCCATGGCAAATAGGAAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002137
VALIDATED
HNRNPA2B1 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein A2/B1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002137.3-782s21c1
Sequence:CCGGGTGGAAGAGGAGGCAACTTTGCTCGAGCAAAGTTGCCTCCTCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002137.3-594s21c1
Sequence:CCGGTGATACCATTGAGATAATTACCTCGAGGTAATTATCTCAATGGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002137.3-1312s21c1
Sequence:CCGGAGCTTCAGGTTATCGAAATAACTCGAGTTATTTCGATAACCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002137.3-880s21c1
Sequence:CCGGTATGGCAGTGGACGTGGATTTCTCGAGAAATCCACGTCCACTGCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002137.3-694s21c1
Sequence:CCGGCAGAAATACCATACCATCAATCTCGAGATTGATGGTATGGTATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002137.3-1642s21c1
Sequence:CCGGAGCCAGGATCATGGTGTAATACTCGAGTATTACACCATGATCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002137.x-468s1c1
Sequence:CCGGAGAAGCTGTTTGTTGGCGGAACTCGAGTTCCGCCAACAAACAGCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002137.x-994s1c1
Sequence:CCGGTGACAACTATGGAGGAGGAAACTCGAGTTTCCTCCTCCATAGTTGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002137.x-701s1c1
Sequence:CCGGAGACAAGAAATGCAGGAAGTTCTCGAGAACTTCCTGCATTTCTTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002137.x-647s1c1
Sequence:CCGGCAGAAATACCATACCATCAATCTCGAGATTGATGGTATGGTATTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002137.x-1196s1c1
Sequence:CCGGGCTTCTTCCTATTTGCCATGGCTCGAGCCATGGCAAATAGGAAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002137
VALIDATED
HNRNPA2B1 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein A2/B1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002137.3-782s21c1
Sequence:CCGGGTGGAAGAGGAGGCAACTTTGCTCGAGCAAAGTTGCCTCCTCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002137.3-594s21c1
Sequence:CCGGTGATACCATTGAGATAATTACCTCGAGGTAATTATCTCAATGGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002137.3-1312s21c1
Sequence:CCGGAGCTTCAGGTTATCGAAATAACTCGAGTTATTTCGATAACCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002137.3-880s21c1
Sequence:CCGGTATGGCAGTGGACGTGGATTTCTCGAGAAATCCACGTCCACTGCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002137.3-694s21c1
Sequence:CCGGCAGAAATACCATACCATCAATCTCGAGATTGATGGTATGGTATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002137.3-1642s21c1
Sequence:CCGGAGCCAGGATCATGGTGTAATACTCGAGTATTACACCATGATCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002137.x-468s1c1
Sequence:CCGGAGAAGCTGTTTGTTGGCGGAACTCGAGTTCCGCCAACAAACAGCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002137.x-994s1c1
Sequence:CCGGTGACAACTATGGAGGAGGAAACTCGAGTTTCCTCCTCCATAGTTGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002137.x-701s1c1
Sequence:CCGGAGACAAGAAATGCAGGAAGTTCTCGAGAACTTCCTGCATTTCTTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002137.x-647s1c1
Sequence:CCGGCAGAAATACCATACCATCAATCTCGAGATTGATGGTATGGTATTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002137.x-1196s1c1
Sequence:CCGGGCTTCTTCCTATTTGCCATGGCTCGAGCCATGGCAAATAGGAAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182650
VALIDATED
HNRNPA2B1 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein A2/B1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182650.3-989s21c1
Sequence:CCGGGCCTTCTAACTATGGTCCAATCTCGAGATTGGACCATAGTTAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182650.3-617s21c1
Sequence:CCGGCGATAGGCAGTCTGGAAAGAACTCGAGTTCTTTCCAGACTGCCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182650.3-718s21c1
Sequence:CCGGGTCACAATGCAGAAGTTAGAACTCGAGTTCTAACTTCTGCATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182650.3-432s21c1
Sequence:CCGGCATTCCATTGATGGCAGGGTACTCGAGTACCCTGCCATCAATGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182650.2-669s1c1
Sequence:CCGGGTCACAATGCAGAAGTTAGAACTCGAGTTCTAACTTCTGCATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182650.2-568s1c1
Sequence:CCGGCGATAGGCAGTCTGGAAAGAACTCGAGTTCTTTCCAGACTGCCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182650.2-383s1c1
Sequence:CCGGCATTCCATTGATGGCAGGGTACTCGAGTACCCTGCCATCAATGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182650.2-888s1c1
Sequence:CCGGGAGGAAATTATGGAAGTGGAACTCGAGTTCCACTTCCATAATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182650
VALIDATED
HNRNPA2B1 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein A2/B1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182650.3-989s21c1
Sequence:CCGGGCCTTCTAACTATGGTCCAATCTCGAGATTGGACCATAGTTAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182650.3-617s21c1
Sequence:CCGGCGATAGGCAGTCTGGAAAGAACTCGAGTTCTTTCCAGACTGCCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182650.3-718s21c1
Sequence:CCGGGTCACAATGCAGAAGTTAGAACTCGAGTTCTAACTTCTGCATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182650.3-432s21c1
Sequence:CCGGCATTCCATTGATGGCAGGGTACTCGAGTACCCTGCCATCAATGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182650.2-669s1c1
Sequence:CCGGGTCACAATGCAGAAGTTAGAACTCGAGTTCTAACTTCTGCATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182650.2-568s1c1
Sequence:CCGGCGATAGGCAGTCTGGAAAGAACTCGAGTTCTTTCCAGACTGCCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182650.2-383s1c1
Sequence:CCGGCATTCCATTGATGGCAGGGTACTCGAGTACCCTGCCATCAATGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182650.2-888s1c1
Sequence:CCGGGAGGAAATTATGGAAGTGGAACTCGAGTTCCACTTCCATAATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182650
VALIDATED
HNRNPA2B1 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein A2/B1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182650.3-989s21c1
Sequence:CCGGGCCTTCTAACTATGGTCCAATCTCGAGATTGGACCATAGTTAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182650.3-617s21c1
Sequence:CCGGCGATAGGCAGTCTGGAAAGAACTCGAGTTCTTTCCAGACTGCCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182650.3-718s21c1
Sequence:CCGGGTCACAATGCAGAAGTTAGAACTCGAGTTCTAACTTCTGCATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182650.3-432s21c1
Sequence:CCGGCATTCCATTGATGGCAGGGTACTCGAGTACCCTGCCATCAATGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182650.2-669s1c1
Sequence:CCGGGTCACAATGCAGAAGTTAGAACTCGAGTTCTAACTTCTGCATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182650.2-568s1c1
Sequence:CCGGCGATAGGCAGTCTGGAAAGAACTCGAGTTCTTTCCAGACTGCCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182650.2-383s1c1
Sequence:CCGGCATTCCATTGATGGCAGGGTACTCGAGTACCCTGCCATCAATGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182650.2-888s1c1
Sequence:CCGGGAGGAAATTATGGAAGTGGAACTCGAGTTCCACTTCCATAATTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks