EMAIL THIS PAGE TO A FRIEND

HNRNPH2

heterogeneous nuclear ribonucleoprotein H2 (H')

Synonyms: FTP3 HNRPH' HNRPH2 hnRNPH'
UniProtKB ID: P55795, A1L400, Q9HHA7
Gene ID:
Human(3188) Summary: This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that binds to RNAs. It is very similar to the family member HNRPH1. This gene is thought to be involved in Fabray disease and X-linked agammaglobulinemia phenotype. Alternative splicing results in multiple transcript variants encoding the same protein. Read-through transcription between this locus and the ribosomal protein L36a gene has been observed. [provided by RefSeq, Jan 2011]
Mouse(56258) heterogeneous nuclear ribonucleoprotein H2
Rat(308650) heterogeneous nuclear ribonucleoprotein H2 (H')
domestic cat(101088556) heterogeneous nuclear ribonucleoprotein H2 (H')
cow(534001) heterogeneous nuclear ribonucleoprotein H2 (H')
Horse(100057665) heterogeneous nuclear ribonucleoprotein H2 (H')
dog(480989) heterogeneous nuclear ribonucleoprotein H2 (H')
sheep(101106495) heterogeneous nuclear ribonucleoprotein H2 (H')
domestic guinea pig(100733040) heterogeneous nuclear ribonucleoprotein H2 (H')
naked mole-rat(101714405) heterogeneous nuclear ribonucleoprotein H2 (H')
129 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019597 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019597 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019597 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019868 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019868 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019868 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032393 Rosetta Predictions human pricing
NM_019597 Rosetta Predictions human pricing
NM_001014019 Rosetta Predictions rat pricing
NM_019868 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123018 predicted 1550
2 SASI_Hs01_00123019 predicted 1544
3 SASI_Hs01_00123020 predicted 1510
4 SASI_Hs01_00123021 predicted 1522
5 SASI_Hs01_00123022 predicted 1098
6 SASI_Hs01_00123024 predicted 1594
7 SASI_Hs01_00123025 predicted 1126
8 SASI_Hs01_00123026 predicted 742
9 SASI_Hs01_00123027 predicted 1353
10 SASI_Hs02_00307942 predicted 363
11 SASI_Hs01_00123023 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209676 predicted 1560
2 SASI_Hs01_00209677 predicted 1551
3 SASI_Hs01_00209678 predicted 1531
4 SASI_Hs01_00209679 predicted 1526
5 SASI_Hs01_00209680 predicted 1104
6 SASI_Hs01_00209682 predicted 1604
7 SASI_Hs01_00209683 predicted 1143
8 SASI_Hs01_00209684 predicted 753
9 SASI_Hs01_00209685 predicted 1363
10 SASI_Hs02_00352799 predicted 369
11 SASI_Hs01_00209681 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051810 predicted 1028
2 SASI_Rn01_00051811 predicted 753
3 SASI_Rn01_00051812 predicted 960
4 SASI_Rn01_00051813 predicted 412
5 SASI_Rn01_00051814 predicted 517
6 SASI_Rn01_00051815 predicted 1415
7 SASI_Rn01_00051816 predicted 388
8 SASI_Rn01_00051818 predicted 1414
9 SASI_Rn01_00051819 predicted 410
10 SASI_Rn02_00201401 predicted 1038
11 SASI_Rn01_00051817 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147960 predicted 1382
2 SASI_Mm01_00147961 predicted 792
3 SASI_Mm02_00325168 predicted 1148
4 SASI_Mm01_00147963 predicted 1020
5 SASI_Mm01_00147964 predicted 406
6 SASI_Mm01_00147965 predicted 950
7 SASI_Mm01_00147966 predicted 1417
8 SASI_Mm01_00147967 predicted 289
9 SASI_Mm01_00147968 predicted 1154
10 SASI_Mm02_00325169 predicted 418
11 SASI_Mm01_00147962 predicted 815
12 SASI_Mm01_00147969 predicted 1008
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019597
VALIDATED
HNRNPH2 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein H2 (H')
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019597.3-327s21c1
Sequence:CCGGCCAAGTGGTGAAGCATTTGTTCTCGAGAACAAATGCTTCACCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019597.3-1111s21c1
Sequence:CCGGCCATGAGAGTACATATTGAAACTCGAGTTTCAATATGTACTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019597.3-1745s21c1
Sequence:CCGGGCTTACTGTAAAGTGGAAGTTCTCGAGAACTTCCACTTTACAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019597.3-672s21c1
Sequence:CCGGGCCTTAAAGAAACACAAGGAACTCGAGTTCCTTGTGTTTCTTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019597.2-1653s1c1
Sequence:CCGGGCTTACTGTAAAGTGGAAGTTCTCGAGAACTTCCACTTTACAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_019597.2-1018s1c1
Sequence:CCGGCCCATGAGAGTACATATTGAACTCGAGTTCAATATGTACTCTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019597.2-580s1c1
Sequence:CCGGGCCTTAAAGAAACACAAGGAACTCGAGTTCCTTGTGTTTCTTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019597.2-235s1c1
Sequence:CCGGCCAAGTGGTGAAGCATTTGTTCTCGAGAACAAATGCTTCACCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019597.2-1019s1c1
Sequence:CCGGCCATGAGAGTACATATTGAAACTCGAGTTTCAATATGTACTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019597
VALIDATED
HNRNPH2 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein H2 (H')
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019597.3-327s21c1
Sequence:CCGGCCAAGTGGTGAAGCATTTGTTCTCGAGAACAAATGCTTCACCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019597.3-1111s21c1
Sequence:CCGGCCATGAGAGTACATATTGAAACTCGAGTTTCAATATGTACTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019597.3-1745s21c1
Sequence:CCGGGCTTACTGTAAAGTGGAAGTTCTCGAGAACTTCCACTTTACAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019597.3-672s21c1
Sequence:CCGGGCCTTAAAGAAACACAAGGAACTCGAGTTCCTTGTGTTTCTTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019597.2-1653s1c1
Sequence:CCGGGCTTACTGTAAAGTGGAAGTTCTCGAGAACTTCCACTTTACAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_019597.2-1018s1c1
Sequence:CCGGCCCATGAGAGTACATATTGAACTCGAGTTCAATATGTACTCTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019597.2-580s1c1
Sequence:CCGGGCCTTAAAGAAACACAAGGAACTCGAGTTCCTTGTGTTTCTTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019597.2-235s1c1
Sequence:CCGGCCAAGTGGTGAAGCATTTGTTCTCGAGAACAAATGCTTCACCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019597.2-1019s1c1
Sequence:CCGGCCATGAGAGTACATATTGAAACTCGAGTTTCAATATGTACTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019597
VALIDATED
HNRNPH2 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein H2 (H')
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019597.3-327s21c1
Sequence:CCGGCCAAGTGGTGAAGCATTTGTTCTCGAGAACAAATGCTTCACCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019597.3-1111s21c1
Sequence:CCGGCCATGAGAGTACATATTGAAACTCGAGTTTCAATATGTACTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019597.3-1745s21c1
Sequence:CCGGGCTTACTGTAAAGTGGAAGTTCTCGAGAACTTCCACTTTACAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019597.3-672s21c1
Sequence:CCGGGCCTTAAAGAAACACAAGGAACTCGAGTTCCTTGTGTTTCTTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019597.2-1653s1c1
Sequence:CCGGGCTTACTGTAAAGTGGAAGTTCTCGAGAACTTCCACTTTACAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_019597.2-1018s1c1
Sequence:CCGGCCCATGAGAGTACATATTGAACTCGAGTTCAATATGTACTCTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019597.2-580s1c1
Sequence:CCGGGCCTTAAAGAAACACAAGGAACTCGAGTTCCTTGTGTTTCTTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019597.2-235s1c1
Sequence:CCGGCCAAGTGGTGAAGCATTTGTTCTCGAGAACAAATGCTTCACCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019597.2-1019s1c1
Sequence:CCGGCCATGAGAGTACATATTGAAACTCGAGTTTCAATATGTACTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019868
VALIDATED
HNRNPH2 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein H2 (H')
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019868.3-480s21c1
Sequence:CCGGCCAACAGTGTTGAAATGGATTCTCGAGAATCCATTTCAACACTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019868.3-383s21c1
Sequence:CCGGGAAGCATTTGTCGAACTTGAACTCGAGTTCAAGTTCGACAAATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019868.3-1795s21c1
Sequence:CCGGGCTTACTGTAAAGTGAAAGTTCTCGAGAACTTTCACTTTACAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019868.3-748s21c1
Sequence:CCGGGCATAGGTACATCGAAATCTTCTCGAGAAGATTTCGATGTACCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019868.2-749s1c1
Sequence:CCGGGCATAGGTACATCGAAATCTTCTCGAGAAGATTTCGATGTACCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019868.2-1170s1c1
Sequence:CCGGCACATTGAAATAGGACCTGATCTCGAGATCAGGTCCTATTTCAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019868.2-384s1c1
Sequence:CCGGGAAGCATTTGTCGAACTTGAACTCGAGTTCAAGTTCGACAAATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019868.2-481s1c1
Sequence:CCGGCCAACAGTGTTGAAATGGATTCTCGAGAATCCATTTCAACACTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019868.2-1796s1c1
Sequence:CCGGGCTTACTGTAAAGTGAAAGTTCTCGAGAACTTTCACTTTACAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019868
VALIDATED
HNRNPH2 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein H2 (H')
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019868.3-480s21c1
Sequence:CCGGCCAACAGTGTTGAAATGGATTCTCGAGAATCCATTTCAACACTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019868.3-383s21c1
Sequence:CCGGGAAGCATTTGTCGAACTTGAACTCGAGTTCAAGTTCGACAAATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019868.3-1795s21c1
Sequence:CCGGGCTTACTGTAAAGTGAAAGTTCTCGAGAACTTTCACTTTACAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019868.3-748s21c1
Sequence:CCGGGCATAGGTACATCGAAATCTTCTCGAGAAGATTTCGATGTACCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019868.2-749s1c1
Sequence:CCGGGCATAGGTACATCGAAATCTTCTCGAGAAGATTTCGATGTACCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019868.2-1170s1c1
Sequence:CCGGCACATTGAAATAGGACCTGATCTCGAGATCAGGTCCTATTTCAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019868.2-384s1c1
Sequence:CCGGGAAGCATTTGTCGAACTTGAACTCGAGTTCAAGTTCGACAAATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019868.2-481s1c1
Sequence:CCGGCCAACAGTGTTGAAATGGATTCTCGAGAATCCATTTCAACACTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019868.2-1796s1c1
Sequence:CCGGGCTTACTGTAAAGTGAAAGTTCTCGAGAACTTTCACTTTACAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019868
VALIDATED
HNRNPH2 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein H2 (H')
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019868.3-480s21c1
Sequence:CCGGCCAACAGTGTTGAAATGGATTCTCGAGAATCCATTTCAACACTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019868.3-383s21c1
Sequence:CCGGGAAGCATTTGTCGAACTTGAACTCGAGTTCAAGTTCGACAAATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019868.3-1795s21c1
Sequence:CCGGGCTTACTGTAAAGTGAAAGTTCTCGAGAACTTTCACTTTACAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019868.3-748s21c1
Sequence:CCGGGCATAGGTACATCGAAATCTTCTCGAGAAGATTTCGATGTACCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019868.2-749s1c1
Sequence:CCGGGCATAGGTACATCGAAATCTTCTCGAGAAGATTTCGATGTACCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019868.2-1170s1c1
Sequence:CCGGCACATTGAAATAGGACCTGATCTCGAGATCAGGTCCTATTTCAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019868.2-384s1c1
Sequence:CCGGGAAGCATTTGTCGAACTTGAACTCGAGTTCAAGTTCGACAAATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019868.2-481s1c1
Sequence:CCGGCCAACAGTGTTGAAATGGATTCTCGAGAATCCATTTCAACACTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019868.2-1796s1c1
Sequence:CCGGGCTTACTGTAAAGTGAAAGTTCTCGAGAACTTTCACTTTACAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks