EMAIL THIS PAGE TO A FRIEND

HNRNPK

heterogeneous nuclear ribonucleoprotein K

Synonyms: CSBP HNRPK TUNP
Gene ID:
Human(3190) Summary: This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene is located in the nucleoplasm and has three repeats of KH domains that binds to RNAs. It is distinct among other hnRNP proteins in its binding preference; it binds tenaciously to poly(C). This protein is also thought to have a role during cell cycle progession. Several alternatively spliced transcript variants have been described for this gene, however, not all of them are fully characterized. [provided by RefSeq, Jul 2008]
Mouse(15387) heterogeneous nuclear ribonucleoprotein K
Rat(117282) heterogeneous nuclear ribonucleoprotein K
Zebrafish(406267) heterogeneous nuclear ribonucleoprotein K
cow(528135) heterogeneous nuclear ribonucleoprotein K
Horse(100052735) heterogeneous nuclear ribonucleoprotein K
domestic cat(101099911) heterogeneous nuclear ribonucleoprotein K
dog(100855638) heterogeneous nuclear ribonucleoprotein K
chicken(427458) heterogeneous nuclear ribonucleoprotein K-like
Goat(100861302) heterogeneous nuclear ribonucleoprotein K
sheep(101117560) heterogeneous nuclear ribonucleoprotein K
Domestic Rabbit(100008849) heterogeneous nuclear ribonucleoprotein K
domestic guinea pig(100729110) heterogeneous nuclear ribonucleoprotein K
naked mole-rat(101706445) heterogeneous nuclear ribonucleoprotein K
166 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501424 Anti-HNRNP K antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB1405953 Anti-HNRNPK antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA007644 Anti-HNRNPK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA044105 Anti-HNRNPK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
AV40388 Anti-HNRPK (AB1) antibody produced in rabbit affinity isolated antibody human, rat, horse, canine, bovine, rabbit, rabbit, zebrafish, mouse, guinea pig
immunohistochemistry, western blot pricing
AV40387 Anti-HNRPK (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, canine, mouse, rabbit, guinea pig, rabbit, rat, horse, zebrafish, human
immunohistochemistry, western blot pricing
SAB4504229 Anti-phospho-hnRNP K (pSer284) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
R8903 Monoclonal Anti-hnRNP-K/J antibody produced in mouse clone 3C2, purified immunoglobulin, buffered aqueous solution hamster, human, Xenopus, bovine
ELISA, immunocytochemistry, immunoprecipitation, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002140 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002140 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002140 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025279 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025279 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025279 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065671 MISSION® esiRNA esiRNA human HNRNPK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002140 Rosetta Predictions human pricing
NM_031262 Rosetta Predictions human pricing
NM_031263 Rosetta Predictions human pricing
NM_057141 Rosetta Predictions rat pricing
NM_025279 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333311 predicted 440
2 SASI_Hs02_00333312 predicted 1399
3 SASI_Hs02_00333313 predicted 875
4 SASI_Hs01_00065600 predicted 1396
5 SASI_Hs02_00333314 predicted 649
6 SASI_Hs02_00333315 predicted 945
7 SASI_Hs02_00333316 predicted 770
8 SASI_Hs02_00333317 predicted 772
9 SASI_Hs02_00333318 predicted 871
10 SASI_Hs02_00333319 predicted 713
11 SASI_Hs01_00065601 predicted 1206
12 SASI_Hs01_00065602 predicted 1352
13 SASI_Hs01_00065603 predicted 1483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358652 predicted 443
2 SASI_Hs02_00358653 predicted 1402
3 SASI_Hs02_00358654 predicted 870
4 SASI_Hs01_00111398 predicted 1393
5 SASI_Hs02_00358655 predicted 647
6 SASI_Hs02_00358656 predicted 944
7 SASI_Hs02_00358657 predicted 770
8 SASI_Hs02_00358658 predicted 775
9 SASI_Hs02_00358659 predicted 872
10 SASI_Hs02_00358660 predicted 710
11 SASI_Hs01_00111399 predicted 1201
12 SASI_Hs01_00111400 predicted 1353
13 SASI_Hs01_00111401 predicted 1479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358661 predicted 401
2 SASI_Hs02_00358662 predicted 1361
3 SASI_Hs02_00358663 predicted 843
4 SASI_Hs01_00220336 predicted 1361
5 SASI_Hs02_00358664 predicted 617
6 SASI_Hs02_00358665 predicted 913
7 SASI_Hs02_00358666 predicted 739
8 SASI_Hs02_00358667 predicted 739
9 SASI_Hs02_00358668 predicted 828
10 SASI_Hs02_00358669 predicted 680
11 SASI_Hs01_00220337 predicted 1118
12 SASI_Hs01_00220338 predicted 1265
13 SASI_Hs01_00220339 predicted 1396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121255 predicted 1159
2 SASI_Rn01_00121256 predicted 1165
3 SASI_Rn01_00121254 predicted 474
4 SASI_Rn02_00267095 predicted 582
5 SASI_Rn01_00121258 predicted 593
6 SASI_Rn02_00267096 predicted 639
7 SASI_Rn02_00267097 predicted 549
8 SASI_Rn01_00121259 predicted 1198
9 SASI_Rn01_00121260 predicted 413
10 SASI_Rn02_00267098 predicted 285
11 SASI_Rn01_00121257 predicted 211
12 SASI_Rn01_00121261 predicted 572
13 SASI_Rn01_00121262 predicted 1183
14 SASI_Rn01_00121263 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091018 predicted 333
2 SASI_Mm01_00091019 predicted 1292
3 SASI_Mm01_00091020 predicted 541
4 SASI_Mm01_00091021 predicted 1099
5 SASI_Mm01_00091027 predicted 574
6 SASI_Mm02_00327887 predicted 672
7 SASI_Mm01_00091022 predicted 1316
8 SASI_Mm01_00091023 predicted 1291
9 SASI_Mm01_00091024 predicted 259
10 SASI_Mm02_00327888 predicted 412
11 SASI_Mm01_00091025 predicted 1311
12 SASI_Mm01_00091026 predicted 306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002140
VALIDATED
HNRNPK MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein K
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002140.3-981s21c1
Sequence:CCGGTGATGTTTGATGACCGTCGCGCTCGAGCGCGACGGTCATCAAACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002140.3-1945s21c1
Sequence:CCGGCGTTATTGTTGGTGGTTTAAACTCGAGTTTAAACCACCAACAATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002140.3-1447s21c1
Sequence:CCGGAGATTTGGCTGGATCTATTATCTCGAGATAATAGATCCAGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002140.3-1635s21c1
Sequence:CCGGCAGATGTTGAAGGATTCTAATCTCGAGATTAGAATCCTTCAACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002140.3-1402s21c1
Sequence:CCGGTGATCTTGGTGGACCTATTATCTCGAGATAATAGGTCCACCAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002140.2-2677s1c1
Sequence:CCGGCTCTGTTGTATGTTGGATTATCTCGAGATAATCCAACATACAACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062456    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002140.2-931s1c1
Sequence:CCGGTGATGTTTGATGACCGTCGCGCTCGAGCGCGACGGTCATCAAACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062457    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002140.2-930s1c1
Sequence:CCGGATGATGTTTGATGACCGTCGCCTCGAGGCGACGGTCATCAAACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062455    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002140.2-429s1c1
Sequence:CCGGGCCAGTGTTTCAGTCCCAGACCTCGAGGTCTGGGACTGAAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062454    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_002140.2-428s1c1
Sequence:CCGGTGCCAGTGTTTCAGTCCCAGACTCGAGTCTGGGACTGAAACACTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002140
VALIDATED
HNRNPK MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein K
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002140.3-981s21c1
Sequence:CCGGTGATGTTTGATGACCGTCGCGCTCGAGCGCGACGGTCATCAAACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002140.3-1945s21c1
Sequence:CCGGCGTTATTGTTGGTGGTTTAAACTCGAGTTTAAACCACCAACAATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002140.3-1447s21c1
Sequence:CCGGAGATTTGGCTGGATCTATTATCTCGAGATAATAGATCCAGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002140.3-1635s21c1
Sequence:CCGGCAGATGTTGAAGGATTCTAATCTCGAGATTAGAATCCTTCAACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002140.3-1402s21c1
Sequence:CCGGTGATCTTGGTGGACCTATTATCTCGAGATAATAGGTCCACCAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002140.2-2677s1c1
Sequence:CCGGCTCTGTTGTATGTTGGATTATCTCGAGATAATCCAACATACAACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062456    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002140.2-931s1c1
Sequence:CCGGTGATGTTTGATGACCGTCGCGCTCGAGCGCGACGGTCATCAAACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062457    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002140.2-930s1c1
Sequence:CCGGATGATGTTTGATGACCGTCGCCTCGAGGCGACGGTCATCAAACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062455    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002140.2-429s1c1
Sequence:CCGGGCCAGTGTTTCAGTCCCAGACCTCGAGGTCTGGGACTGAAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062454    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_002140.2-428s1c1
Sequence:CCGGTGCCAGTGTTTCAGTCCCAGACTCGAGTCTGGGACTGAAACACTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002140
VALIDATED
HNRNPK MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein K
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002140.3-981s21c1
Sequence:CCGGTGATGTTTGATGACCGTCGCGCTCGAGCGCGACGGTCATCAAACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002140.3-1945s21c1
Sequence:CCGGCGTTATTGTTGGTGGTTTAAACTCGAGTTTAAACCACCAACAATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002140.3-1447s21c1
Sequence:CCGGAGATTTGGCTGGATCTATTATCTCGAGATAATAGATCCAGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002140.3-1635s21c1
Sequence:CCGGCAGATGTTGAAGGATTCTAATCTCGAGATTAGAATCCTTCAACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002140.3-1402s21c1
Sequence:CCGGTGATCTTGGTGGACCTATTATCTCGAGATAATAGGTCCACCAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002140.2-2677s1c1
Sequence:CCGGCTCTGTTGTATGTTGGATTATCTCGAGATAATCCAACATACAACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062456    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002140.2-931s1c1
Sequence:CCGGTGATGTTTGATGACCGTCGCGCTCGAGCGCGACGGTCATCAAACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062457    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002140.2-930s1c1
Sequence:CCGGATGATGTTTGATGACCGTCGCCTCGAGGCGACGGTCATCAAACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062455    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002140.2-429s1c1
Sequence:CCGGGCCAGTGTTTCAGTCCCAGACCTCGAGGTCTGGGACTGAAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062454    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_002140.2-428s1c1
Sequence:CCGGTGCCAGTGTTTCAGTCCCAGACTCGAGTCTGGGACTGAAACACTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025279
VALIDATED
HNRNPK MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein K
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025279.1-1828s1c1
Sequence:CCGGCCTTACTTTGTGGTCACTGTACTCGAGTACAGTGACCACAAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025279.1-1377s1c1
Sequence:CCGGCGGATTAAACAAATTCGTCATCTCGAGATGACGAATTTGTTTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025279.1-620s1c1
Sequence:CCGGAGGAGGAATAATTGGTGTTAACTCGAGTTAACACCAATTATTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025279.1-422s1c1
Sequence:CCGGCAGTGCTGATATTGAGACGATCTCGAGATCGTCTCAATATCAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025279.1-1336s1c1
Sequence:CCGGCCAAAGATTTGGCTGGATCTACTCGAGTAGATCCAGCCAAATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025279
VALIDATED
HNRNPK MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein K
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025279.1-1828s1c1
Sequence:CCGGCCTTACTTTGTGGTCACTGTACTCGAGTACAGTGACCACAAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025279.1-1377s1c1
Sequence:CCGGCGGATTAAACAAATTCGTCATCTCGAGATGACGAATTTGTTTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025279.1-620s1c1
Sequence:CCGGAGGAGGAATAATTGGTGTTAACTCGAGTTAACACCAATTATTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025279.1-422s1c1
Sequence:CCGGCAGTGCTGATATTGAGACGATCTCGAGATCGTCTCAATATCAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025279.1-1336s1c1
Sequence:CCGGCCAAAGATTTGGCTGGATCTACTCGAGTAGATCCAGCCAAATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025279
VALIDATED
HNRNPK MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein K
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025279.1-1828s1c1
Sequence:CCGGCCTTACTTTGTGGTCACTGTACTCGAGTACAGTGACCACAAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025279.1-1377s1c1
Sequence:CCGGCGGATTAAACAAATTCGTCATCTCGAGATGACGAATTTGTTTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025279.1-620s1c1
Sequence:CCGGAGGAGGAATAATTGGTGTTAACTCGAGTTAACACCAATTATTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025279.1-422s1c1
Sequence:CCGGCAGTGCTGATATTGAGACGATCTCGAGATCGTCTCAATATCAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025279.1-1336s1c1
Sequence:CCGGCCAAAGATTTGGCTGGATCTACTCGAGTAGATCCAGCCAAATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks