EMAIL THIS PAGE TO A FRIEND

HNRNPUL2

heterogeneous nuclear ribonucleoprotein U-like 2

Synonyms: HNRPUL2 SAF-A2
UniProtKB ID: Q1KMD3, Q8N3B3
Gene ID:
Mouse(68693) heterogeneous nuclear ribonucleoprotein U-like 2
Rat(309197) heterogeneous nuclear ribonucleoprotein U-like 2
cow(616476) heterogeneous nuclear ribonucleoprotein U-like 2
domestic cat(101087684) heterogeneous nuclear ribonucleoprotein U-like 2
dog(476053) heterogeneous nuclear ribonucleoprotein U-like 2
domestic guinea pig(100733960) heterogeneous nuclear ribonucleoprotein U-like 2
naked mole-rat(101725698) heterogeneous nuclear ribonucleoprotein U-like 2
sheep(101113371) heterogeneous nuclear ribonucleoprotein U-like 2
133 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081196 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081196 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081196 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001079559 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001079559 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001079559 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079559 Rosetta Predictions human pricing
XM_495877 Rosetta Predictions human pricing
XM_001073417 Rosetta Predictions rat pricing
XM_219560 Rosetta Predictions rat pricing
NM_001081196 Rosetta Predictions mouse pricing
XM_355145 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313600 predicted 2127
2 SASI_Hs02_00313601 predicted 2000
3 SASI_Hs02_00313602 predicted 1758
4 SASI_Hs02_00313603 predicted 938
5 SASI_Hs02_00313604 predicted 1743
6 SASI_Hs02_00313605 predicted 1945
7 SASI_Hs02_00313606 predicted 2247
8 SASI_Hs02_00313607 predicted 1967
9 SASI_Hs02_00313608 predicted 981
10 SASI_Hs02_00313609 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_495877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292360 predicted 2267
2 SASI_Hs01_00292361 predicted 2130
3 SASI_Hs01_00292362 predicted 1898
4 SASI_Hs01_00292363 predicted 1072
5 SASI_Hs01_00292364 predicted 1914
6 SASI_Hs01_00292365 predicted 1878
7 SASI_Hs01_00292366 predicted 2390
8 SASI_Hs01_00292367 predicted 2101
9 SASI_Hs01_00292368 predicted 1117
10 SASI_Hs01_00292369 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073417 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342781 predicted 996
2 SASI_Rn02_00342782 predicted 1922
3 SASI_Rn02_00342783 predicted 2141
4 SASI_Rn02_00342784 predicted 1382
5 SASI_Rn02_00342785 predicted 1501
6 SASI_Rn02_00342786 predicted 2074
7 SASI_Rn02_00342787 predicted 1077
8 SASI_Rn02_00342788 predicted 1999
9 SASI_Rn02_00342789 predicted 2132
10 SASI_Rn02_00342790 predicted 1182
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219560 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378555 predicted 1927
2 SASI_Rn02_00378556 predicted 2137
3 SASI_Rn02_00378557 predicted 1318
4 SASI_Rn02_00378558 predicted 1917
5 SASI_Rn02_00378559 predicted 1380
6 SASI_Rn02_00378560 predicted 1501
7 SASI_Rn02_00378561 predicted 2074
8 SASI_Rn02_00378562 predicted 1940
9 SASI_Rn02_00378563 predicted 1994
10 SASI_Rn02_00378564 predicted 2131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296131 predicted 2967
2 SASI_Mm02_00296132 predicted 2437
3 SASI_Mm02_00296133 predicted 1535
4 SASI_Mm02_00296134 predicted 2674
5 SASI_Mm02_00296135 predicted 1408
6 SASI_Mm02_00296136 predicted 2609
7 SASI_Mm02_00296137 predicted 1601
8 SASI_Mm02_00296138 predicted 1617
9 SASI_Mm02_00296139 predicted 2933
10 SASI_Mm02_00296140 predicted 2669
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220149 predicted 2974
2 SASI_Mm01_00220150 predicted 2439
3 SASI_Mm01_00220151 predicted 1535
4 SASI_Mm01_00220152 predicted 2683
5 SASI_Mm01_00220153 predicted 1417
6 SASI_Mm01_00220154 predicted 2623
7 SASI_Mm01_00220155 predicted 1606
8 SASI_Mm01_00220156 predicted 1623
9 SASI_Mm01_00220157 predicted 2937
10 SASI_Mm01_00220158 predicted 2673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081196
VALIDATED
HNRNPUL2 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein U-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081196.1-2973s21c1
Sequence:CCGGCGATTCTACAGTCGAGATTATCTCGAGATAATCTCGACTGTAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081196.1-3768s21c1
Sequence:CCGGGTTGGGTGGTTCTAGTATATACTCGAGTATATACTAGAACCACCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081196.1-2668s21c1
Sequence:CCGGTGCCTGAGAAATGCGACTATACTCGAGTATAGTCGCATTTCTCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081196.1-2621s21c1
Sequence:CCGGTGATGTGCCTGAGTCTATAATCTCGAGATTATAGACTCAGGCACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081196.1-2023s21c1
Sequence:CCGGTGGGTGTGGCATTCCGAATTACTCGAGTAATTCGGAATGCCACACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081196
VALIDATED
HNRNPUL2 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein U-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081196.1-2973s21c1
Sequence:CCGGCGATTCTACAGTCGAGATTATCTCGAGATAATCTCGACTGTAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081196.1-3768s21c1
Sequence:CCGGGTTGGGTGGTTCTAGTATATACTCGAGTATATACTAGAACCACCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081196.1-2668s21c1
Sequence:CCGGTGCCTGAGAAATGCGACTATACTCGAGTATAGTCGCATTTCTCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081196.1-2621s21c1
Sequence:CCGGTGATGTGCCTGAGTCTATAATCTCGAGATTATAGACTCAGGCACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081196.1-2023s21c1
Sequence:CCGGTGGGTGTGGCATTCCGAATTACTCGAGTAATTCGGAATGCCACACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081196
VALIDATED
HNRNPUL2 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein U-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081196.1-2973s21c1
Sequence:CCGGCGATTCTACAGTCGAGATTATCTCGAGATAATCTCGACTGTAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081196.1-3768s21c1
Sequence:CCGGGTTGGGTGGTTCTAGTATATACTCGAGTATATACTAGAACCACCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081196.1-2668s21c1
Sequence:CCGGTGCCTGAGAAATGCGACTATACTCGAGTATAGTCGCATTTCTCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081196.1-2621s21c1
Sequence:CCGGTGATGTGCCTGAGTCTATAATCTCGAGATTATAGACTCAGGCACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081196.1-2023s21c1
Sequence:CCGGTGGGTGTGGCATTCCGAATTACTCGAGTAATTCGGAATGCCACACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001079559
VALIDATED
HNRNPUL2 MISSION shRNA Bacterial Glycerol Stock
heterogeneous nuclear ribonucleoprotein U-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079559.1-1773s21c1
Sequence:CCGGCCCGGACAAAGAGGAACTTTACTCGAGTAAAGTTCCTCTTTGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079559.1-1273s21c1
Sequence:GTACCGGTATTGGCTGCTTTGCTAATTTCTCGAGAAATTAGCAAAGCAGCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079559.1-1651s21c1
Sequence:GTACCGGTGAGACTGTGCTCAATCAAATCTCGAGATTTGATTGAGCACAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001079559.1-2733s21c1
Sequence:CCGGCTTAGGGCTGCCTGTTCTATACTCGAGTATAGAACAGGCAGCCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079559.1-927s21c1
Sequence:CCGGTTGTGAACCTGGACACGTATACTCGAGTATACGTGTCCAGGTTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001079559
VALIDATED
HNRNPUL2 MISSION shRNA shRNA Plasmid DNA
heterogeneous nuclear ribonucleoprotein U-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079559.1-1773s21c1
Sequence:CCGGCCCGGACAAAGAGGAACTTTACTCGAGTAAAGTTCCTCTTTGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079559.1-1273s21c1
Sequence:GTACCGGTATTGGCTGCTTTGCTAATTTCTCGAGAAATTAGCAAAGCAGCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079559.1-1651s21c1
Sequence:GTACCGGTGAGACTGTGCTCAATCAAATCTCGAGATTTGATTGAGCACAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001079559.1-2733s21c1
Sequence:CCGGCTTAGGGCTGCCTGTTCTATACTCGAGTATAGAACAGGCAGCCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079559.1-927s21c1
Sequence:CCGGTTGTGAACCTGGACACGTATACTCGAGTATACGTGTCCAGGTTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001079559
VALIDATED
HNRNPUL2 MISSION shRNA Lentiviral Transduction Particles
heterogeneous nuclear ribonucleoprotein U-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079559.1-1773s21c1
Sequence:CCGGCCCGGACAAAGAGGAACTTTACTCGAGTAAAGTTCCTCTTTGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079559.1-1273s21c1
Sequence:GTACCGGTATTGGCTGCTTTGCTAATTTCTCGAGAAATTAGCAAAGCAGCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079559.1-1651s21c1
Sequence:GTACCGGTGAGACTGTGCTCAATCAAATCTCGAGATTTGATTGAGCACAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001079559.1-2733s21c1
Sequence:CCGGCTTAGGGCTGCCTGTTCTATACTCGAGTATAGAACAGGCAGCCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079559.1-927s21c1
Sequence:CCGGTTGTGAACCTGGACACGTATACTCGAGTATACGTGTCCAGGTTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks