EMAIL THIS PAGE TO A FRIEND

HOMER1

homer homolog 1 (Drosophila)

Synonyms: HOMER HOMER1A HOMER1B HOMER1C SYN47 Ves-1
UniProtKB ID: Q86YM7, B2R688, O96003, Q86YM5
Gene ID:
Human(9456) Summary: This gene encodes a member of the homer family of dendritic proteins. Members of this family regulate group 1 metabotrophic glutamate receptor function. [provided by RefSeq, Jul 2008]
Mouse(26556) homer homolog 1 (Drosophila)
Rat(29546) homer homolog 1 (Drosophila)
Zebrafish(100333527) homer homolog 1 (Drosophila)
cow(535311) homer homolog 1 (Drosophila)
Horse(100065415) homer homolog 1 (Drosophila)
domestic cat(101086036) homer homolog 1 (Drosophila)
dog(488933) homer homolog 1 (Drosophila)
chicken(427181) homer homolog 1 (Drosophila)
Domestic Rabbit(100356113) homer homolog 1 (Drosophila)
domestic guinea pig(100725713) homer homolog 1 (Drosophila)
naked mole-rat(101724666) homer homolog 1 (Drosophila)
219 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152134 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152134 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152134 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004272 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004272 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004272 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004272 Rosetta Predictions human pricing
NM_031707 Rosetta Predictions rat pricing
NM_011982 Rosetta Predictions mouse pricing
NM_147176 Rosetta Predictions mouse pricing
NM_152134 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337250 predicted 1827
2 SASI_Hs01_00161720 predicted 1735
3 SASI_Hs01_00161721 predicted 1531
4 SASI_Hs01_00161723 predicted 1184
5 SASI_Hs01_00161724 predicted 1988
6 SASI_Hs01_00161725 predicted 1463
7 SASI_Hs01_00161726 predicted 2015
8 SASI_Hs01_00161727 predicted 1635
9 SASI_Hs01_00161728 predicted 1140
10 SASI_Hs02_00337251 predicted 1469
11 SASI_Hs01_00161719 predicted 1384
12 SASI_Hs01_00161722 predicted 1549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117777 predicted 480
2 SASI_Rn01_00117778 predicted 408
3 SASI_Rn01_00117779 predicted 1375
4 SASI_Rn01_00117780 predicted 1360
5 SASI_Rn01_00117781 predicted 1289
6 SASI_Rn01_00117782 predicted 380
7 SASI_Rn01_00117783 predicted 844
8 SASI_Rn01_00117784 predicted 705
9 SASI_Rn01_00117785 predicted 1302
10 SASI_Rn01_00117786 predicted 1420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011982 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176961 predicted 1050
2 SASI_Mm02_00321900 predicted 955
3 SASI_Mm01_00176964 predicted 1030
4 SASI_Mm01_00176965 predicted 1060
5 SASI_Mm02_00321901 predicted 877
6 SASI_Mm02_00321902 predicted 1028
7 SASI_Mm02_00321903 predicted 867
8 SASI_Mm01_00176969 predicted 1106
9 SASI_Mm02_00321904 predicted 884
10 SASI_Mm02_00321905 predicted 825
11 SASI_Mm01_00176960 predicted 506
12 SASI_Mm01_00176962 predicted 489
13 SASI_Mm01_00176963 predicted 477
14 SASI_Mm01_00176966 predicted 478
15 SASI_Mm01_00176967 predicted 517
16 SASI_Mm01_00176968 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342684 predicted 1801
2 SASI_Mm02_00342685 predicted 1810
3 SASI_Mm01_00170337 predicted 1047
4 SASI_Mm02_00342686 predicted 2334
5 SASI_Mm02_00342687 predicted 2394
6 SASI_Mm02_00342688 predicted 1687
7 SASI_Mm02_00342689 predicted 2389
8 SASI_Mm02_00342690 predicted 2390
9 SASI_Mm02_00342691 predicted 1034
10 SASI_Mm02_00342692 predicted 1668
11 SASI_Mm01_00170336 predicted 762
12 SASI_Mm01_00170338 predicted 753
13 SASI_Mm01_00170339 predicted 745
14 SASI_Mm01_00170340 predicted 738
15 SASI_Mm01_00170341 predicted 765
16 SASI_Mm01_00170342 predicted 740
17 SASI_Mm01_00170343 predicted 772
18 SASI_Mm01_00170344 predicted 770
19 SASI_Mm01_00170345 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342785 predicted 1285
2 SASI_Mm02_00342786 predicted 1290
3 SASI_Mm01_00039309 predicted 561
4 SASI_Mm02_00342787 predicted 1822
5 SASI_Mm02_00342788 predicted 1880
6 SASI_Mm02_00342789 predicted 1164
7 SASI_Mm02_00342790 predicted 1868
8 SASI_Mm02_00342791 predicted 1870
9 SASI_Mm02_00342792 predicted 544
10 SASI_Mm02_00342793 predicted 1148
11 SASI_Mm01_00039308 predicted 594
12 SASI_Mm01_00039310 predicted 577
13 SASI_Mm01_00039311 predicted 560
14 SASI_Mm01_00039312 predicted 560
15 SASI_Mm01_00039313 predicted 592
16 SASI_Mm01_00039314 predicted 569
17 SASI_Mm01_00039315 predicted 594
18 SASI_Mm01_00039316 predicted 599
19 SASI_Mm01_00039317 predicted 627
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152134
HOMER1 MISSION shRNA Bacterial Glycerol Stock
homer homolog 1 (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152134.1-3071s1c1
Sequence:CCGGCCTGTCTATTATAGAAGGAATCTCGAGATTCCTTCTATAATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152134.1-884s1c1
Sequence:CCGGGCTACCCTCAAAGGCAACAATCTCGAGATTGTTGCCTTTGAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152134.1-1352s1c1
Sequence:CCGGCGAGATAATTTGGCCAAGCTACTCGAGTAGCTTGGCCAAATTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152134.1-370s1c1
Sequence:CCGGTGACCCGAACACAAAGAAGAACTCGAGTTCTTCTTTGTGTTCGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152134.1-409s1c1
Sequence:CCGGGCATGCAGTTACTGTATCTTACTCGAGTAAGATACAGTAACTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152134.2-452s21c1
Sequence:CCGGGTGTATAGGATAATCAGTTTACTCGAGTAAACTGATTATCCTATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152134.2-1198s21c1
Sequence:CCGGGGAAGTTGAAATTCGAAATAACTCGAGTTATTTCGAATTTCAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152134.2-1613s21c1
Sequence:CCGGATGTATATTGGCCATAGTTAACTCGAGTTAACTATGGCCAATATACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152134
HOMER1 MISSION shRNA shRNA Plasmid DNA
homer homolog 1 (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152134.1-3071s1c1
Sequence:CCGGCCTGTCTATTATAGAAGGAATCTCGAGATTCCTTCTATAATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152134.1-884s1c1
Sequence:CCGGGCTACCCTCAAAGGCAACAATCTCGAGATTGTTGCCTTTGAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152134.1-1352s1c1
Sequence:CCGGCGAGATAATTTGGCCAAGCTACTCGAGTAGCTTGGCCAAATTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152134.1-370s1c1
Sequence:CCGGTGACCCGAACACAAAGAAGAACTCGAGTTCTTCTTTGTGTTCGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152134.1-409s1c1
Sequence:CCGGGCATGCAGTTACTGTATCTTACTCGAGTAAGATACAGTAACTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152134.2-452s21c1
Sequence:CCGGGTGTATAGGATAATCAGTTTACTCGAGTAAACTGATTATCCTATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152134.2-1198s21c1
Sequence:CCGGGGAAGTTGAAATTCGAAATAACTCGAGTTATTTCGAATTTCAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152134.2-1613s21c1
Sequence:CCGGATGTATATTGGCCATAGTTAACTCGAGTTAACTATGGCCAATATACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152134
HOMER1 MISSION shRNA Lentiviral Transduction Particles
homer homolog 1 (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152134.1-3071s1c1
Sequence:CCGGCCTGTCTATTATAGAAGGAATCTCGAGATTCCTTCTATAATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152134.1-884s1c1
Sequence:CCGGGCTACCCTCAAAGGCAACAATCTCGAGATTGTTGCCTTTGAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152134.1-1352s1c1
Sequence:CCGGCGAGATAATTTGGCCAAGCTACTCGAGTAGCTTGGCCAAATTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152134.1-370s1c1
Sequence:CCGGTGACCCGAACACAAAGAAGAACTCGAGTTCTTCTTTGTGTTCGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152134.1-409s1c1
Sequence:CCGGGCATGCAGTTACTGTATCTTACTCGAGTAAGATACAGTAACTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152134.2-452s21c1
Sequence:CCGGGTGTATAGGATAATCAGTTTACTCGAGTAAACTGATTATCCTATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152134.2-1198s21c1
Sequence:CCGGGGAAGTTGAAATTCGAAATAACTCGAGTTATTTCGAATTTCAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152134.2-1613s21c1
Sequence:CCGGATGTATATTGGCCATAGTTAACTCGAGTTAACTATGGCCAATATACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004272
VALIDATED
HOMER1 MISSION shRNA Bacterial Glycerol Stock
homer homolog 1 (Drosophila)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004272.3-3874s1c1
Sequence:CCGGGCTGTAACATCATGTACGTTACTCGAGTAACGTACATGATGTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004272.3-2078s1c1
Sequence:CCGGCCTGAAGACACTCTTAGAAATCTCGAGATTTCTAAGAGTGTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004272.3-2664s1c1
Sequence:CCGGGCAGTGCCATTACCAATTAATCTCGAGATTAATTGGTAATGGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004272.3-2868s1c1
Sequence:CCGGGAGAAGATATTGTCTCCCATTCTCGAGAATGGGAGACAATATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183482    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004272.3-3967s1c1
Sequence:CCGGGCTGAGATATTTCTCTGATAACTCGAGTTATCAGAGAAATATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004272.3-1813s1c1
Sequence:CCGGGCCAAGCAAATGCAGTACATACTCGAGTATGTACTGCATTTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004272.3-1714s1c1
Sequence:CCGGCCACTGCCAATGTGAAACAATCTCGAGATTGTTTCACATTGGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004272.3-2120s1c1
Sequence:CCGGACTAACAGAATTACGAGATAACTCGAGTTATCTCGTAATTCTGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004272.3-1380s1c1
Sequence:CCGGGAGCATCATCTTTCGAAATTTCTCGAGAAATTTCGAAAGATGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004272.3-1233s1c1
Sequence:CCGGGTGTATAGGATAATCAGTTTACTCGAGTAAACTGATTATCCTATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004272.3-1233s21c1
Sequence:CCGGGTGTATAGGATAATCAGTTTACTCGAGTAAACTGATTATCCTATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004272.3-1380s21c1
Sequence:CCGGGAGCATCATCTTTCGAAATTTCTCGAGAAATTTCGAAAGATGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004272.3-2121s21c1
Sequence:CCGGCTAACAGAATTACGAGATAACCTCGAGGTTATCTCGTAATTCTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004272.3-2078s21c1
Sequence:CCGGCCTGAAGACACTCTTAGAAATCTCGAGATTTCTAAGAGTGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004272
VALIDATED
HOMER1 MISSION shRNA shRNA Plasmid DNA
homer homolog 1 (Drosophila)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004272.3-3874s1c1
Sequence:CCGGGCTGTAACATCATGTACGTTACTCGAGTAACGTACATGATGTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004272.3-2078s1c1
Sequence:CCGGCCTGAAGACACTCTTAGAAATCTCGAGATTTCTAAGAGTGTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004272.3-2664s1c1
Sequence:CCGGGCAGTGCCATTACCAATTAATCTCGAGATTAATTGGTAATGGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004272.3-2868s1c1
Sequence:CCGGGAGAAGATATTGTCTCCCATTCTCGAGAATGGGAGACAATATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183482    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004272.3-3967s1c1
Sequence:CCGGGCTGAGATATTTCTCTGATAACTCGAGTTATCAGAGAAATATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004272.3-1813s1c1
Sequence:CCGGGCCAAGCAAATGCAGTACATACTCGAGTATGTACTGCATTTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004272.3-1714s1c1
Sequence:CCGGCCACTGCCAATGTGAAACAATCTCGAGATTGTTTCACATTGGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004272.3-2120s1c1
Sequence:CCGGACTAACAGAATTACGAGATAACTCGAGTTATCTCGTAATTCTGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004272.3-1380s1c1
Sequence:CCGGGAGCATCATCTTTCGAAATTTCTCGAGAAATTTCGAAAGATGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004272.3-1233s1c1
Sequence:CCGGGTGTATAGGATAATCAGTTTACTCGAGTAAACTGATTATCCTATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004272.3-1233s21c1
Sequence:CCGGGTGTATAGGATAATCAGTTTACTCGAGTAAACTGATTATCCTATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004272.3-1380s21c1
Sequence:CCGGGAGCATCATCTTTCGAAATTTCTCGAGAAATTTCGAAAGATGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004272.3-2121s21c1
Sequence:CCGGCTAACAGAATTACGAGATAACCTCGAGGTTATCTCGTAATTCTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004272.3-2078s21c1
Sequence:CCGGCCTGAAGACACTCTTAGAAATCTCGAGATTTCTAAGAGTGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004272
VALIDATED
HOMER1 MISSION shRNA Lentiviral Transduction Particles
homer homolog 1 (Drosophila)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004272.3-3874s1c1
Sequence:CCGGGCTGTAACATCATGTACGTTACTCGAGTAACGTACATGATGTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004272.3-2078s1c1
Sequence:CCGGCCTGAAGACACTCTTAGAAATCTCGAGATTTCTAAGAGTGTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004272.3-2664s1c1
Sequence:CCGGGCAGTGCCATTACCAATTAATCTCGAGATTAATTGGTAATGGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004272.3-2868s1c1
Sequence:CCGGGAGAAGATATTGTCTCCCATTCTCGAGAATGGGAGACAATATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183482    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004272.3-3967s1c1
Sequence:CCGGGCTGAGATATTTCTCTGATAACTCGAGTTATCAGAGAAATATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004272.3-1813s1c1
Sequence:CCGGGCCAAGCAAATGCAGTACATACTCGAGTATGTACTGCATTTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004272.3-1714s1c1
Sequence:CCGGCCACTGCCAATGTGAAACAATCTCGAGATTGTTTCACATTGGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004272.3-2120s1c1
Sequence:CCGGACTAACAGAATTACGAGATAACTCGAGTTATCTCGTAATTCTGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004272.3-1380s1c1
Sequence:CCGGGAGCATCATCTTTCGAAATTTCTCGAGAAATTTCGAAAGATGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_004272.3-1233s1c1
Sequence:CCGGGTGTATAGGATAATCAGTTTACTCGAGTAAACTGATTATCCTATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004272.3-1233s21c1
Sequence:CCGGGTGTATAGGATAATCAGTTTACTCGAGTAAACTGATTATCCTATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004272.3-1380s21c1
Sequence:CCGGGAGCATCATCTTTCGAAATTTCTCGAGAAATTTCGAAAGATGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004272.3-2121s21c1
Sequence:CCGGCTAACAGAATTACGAGATAACCTCGAGGTTATCTCGTAATTCTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004272.3-2078s21c1
Sequence:CCGGCCTGAAGACACTCTTAGAAATCTCGAGATTTCTAAGAGTGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks