EMAIL THIS PAGE TO A FRIEND

HOXB2

homeobox B2

Synonyms: HOX2 HOX2H Hox-2.8 K8
UniProtKB ID: P14652, P10913, P17485
Gene ID:
Human(3212) Summary: This gene is a member of the Antp homeobox family and encodes a nuclear protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in development. Increased expression of this gene is associated with pancreatic cancer. [provided by RefSeq, Jul 2008]
Mouse(103889) homeobox B2
Rat(100361765) homeobox B2
chicken(429940) homeobox B2
dog(608880) homeobox B2
cow(616129) homeobox B2
sheep(101121362) homeobox B2
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134032 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134032 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134032 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002145 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002145 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002145 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002145 Rosetta Predictions human pricing
NM_134032 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036236 predicted 1260
2 SASI_Hs01_00036238 predicted 1317
3 SASI_Hs01_00036239 predicted 1250
4 SASI_Hs01_00036241 predicted 1304
5 SASI_Hs01_00036242 predicted 1216
6 SASI_Hs01_00036243 predicted 1267
7 SASI_Hs01_00036244 predicted 1303
8 SASI_Hs01_00036245 predicted 1258
9 SASI_Hs02_00333327 predicted 1310
10 SASI_Hs02_00333328 predicted 1263
11 SASI_Hs01_00036237 predicted 1171
12 SASI_Hs01_00036240 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134032 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116284 predicted 1358
2 SASI_Mm01_00116285 predicted 1351
3 SASI_Mm01_00116286 predicted 1361
4 SASI_Mm01_00116287 predicted 1119
5 SASI_Mm01_00116288 predicted 1356
6 SASI_Mm01_00116289 predicted 1216
7 SASI_Mm01_00116290 predicted 747
8 SASI_Mm01_00116291 predicted 720
9 SASI_Mm02_00339195 predicted 1307
10 SASI_Mm02_00339196 predicted 1252
11 SASI_Mm01_00116283 predicted 1234
12 SASI_Mm01_00116292 predicted 1110
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134032
HOXB2 MISSION shRNA Bacterial Glycerol Stock
homeobox B2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134032.2-256s21c1
Sequence:CCGGCCGCTGTCTTGGAGACATTTCCTCGAGGAAATGTCTCCAAGACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134032.2-1313s21c1
Sequence:CCGGTCTCCACTCGTGGATACATTTCTCGAGAAATGTATCCACGAGTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134032.2-1350s21c1
Sequence:CCGGATCCAGATAGTAACGAATTAGCTCGAGCTAATTCGTTACTATCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134032.2-285s21c1
Sequence:CCGGTCAATCAAGGAGTCGACATTACTCGAGTAATGTCGACTCCTTGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134032.1-646s1c1
Sequence:CCGGCGAGCGGCAGGATTCGCCTTTCTCGAGAAAGGCGAATCCTGCCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134032.1-808s1c1
Sequence:CCGGCATCGACTTGCAGTTTCCCTACTCGAGTAGGGAAACTGCAAGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134032.1-545s1c1
Sequence:CCGGCCTGCCACCACCCTGGAGAGTCTCGAGACTCTCCAGGGTGGTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134032.1-676s1c1
Sequence:CCGGCCTCAATTTCTTCGCTGCAGACTCGAGTCTGCAGCGAAGAAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134032.1-803s1c1
Sequence:CCGGTGTGCCATCGACTTGCAGTTTCTCGAGAAACTGCAAGTCGATGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134032
HOXB2 MISSION shRNA shRNA Plasmid DNA
homeobox B2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134032.2-256s21c1
Sequence:CCGGCCGCTGTCTTGGAGACATTTCCTCGAGGAAATGTCTCCAAGACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134032.2-1313s21c1
Sequence:CCGGTCTCCACTCGTGGATACATTTCTCGAGAAATGTATCCACGAGTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134032.2-1350s21c1
Sequence:CCGGATCCAGATAGTAACGAATTAGCTCGAGCTAATTCGTTACTATCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134032.2-285s21c1
Sequence:CCGGTCAATCAAGGAGTCGACATTACTCGAGTAATGTCGACTCCTTGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134032.1-646s1c1
Sequence:CCGGCGAGCGGCAGGATTCGCCTTTCTCGAGAAAGGCGAATCCTGCCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134032.1-808s1c1
Sequence:CCGGCATCGACTTGCAGTTTCCCTACTCGAGTAGGGAAACTGCAAGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134032.1-545s1c1
Sequence:CCGGCCTGCCACCACCCTGGAGAGTCTCGAGACTCTCCAGGGTGGTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134032.1-676s1c1
Sequence:CCGGCCTCAATTTCTTCGCTGCAGACTCGAGTCTGCAGCGAAGAAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134032.1-803s1c1
Sequence:CCGGTGTGCCATCGACTTGCAGTTTCTCGAGAAACTGCAAGTCGATGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134032
HOXB2 MISSION shRNA Lentiviral Transduction Particles
homeobox B2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134032.2-256s21c1
Sequence:CCGGCCGCTGTCTTGGAGACATTTCCTCGAGGAAATGTCTCCAAGACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134032.2-1313s21c1
Sequence:CCGGTCTCCACTCGTGGATACATTTCTCGAGAAATGTATCCACGAGTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134032.2-1350s21c1
Sequence:CCGGATCCAGATAGTAACGAATTAGCTCGAGCTAATTCGTTACTATCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134032.2-285s21c1
Sequence:CCGGTCAATCAAGGAGTCGACATTACTCGAGTAATGTCGACTCCTTGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134032.1-646s1c1
Sequence:CCGGCGAGCGGCAGGATTCGCCTTTCTCGAGAAAGGCGAATCCTGCCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134032.1-808s1c1
Sequence:CCGGCATCGACTTGCAGTTTCCCTACTCGAGTAGGGAAACTGCAAGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134032.1-545s1c1
Sequence:CCGGCCTGCCACCACCCTGGAGAGTCTCGAGACTCTCCAGGGTGGTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134032.1-676s1c1
Sequence:CCGGCCTCAATTTCTTCGCTGCAGACTCGAGTCTGCAGCGAAGAAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134032.1-803s1c1
Sequence:CCGGTGTGCCATCGACTTGCAGTTTCTCGAGAAACTGCAAGTCGATGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002145
VALIDATED
HOXB2 MISSION shRNA Bacterial Glycerol Stock
homeobox B2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002145.3-1308s21c1
Sequence:CCGGTTACTGAATTAGCGTTTAATCCTCGAGGATTAAACGCTAATTCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002145.3-226s21c1
Sequence:CCGGTCAATCAAGGAGTCGACATTACTCGAGTAATGTCGACTCCTTGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002145.3-1128s21c1
Sequence:CCGGTTCCGAGGAAGAGCTGGATTTCTCGAGAAATCCAGCTCTTCCTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002145.3-398s21c1
Sequence:CCGGCCGAGTTCCCTTGGATGAAAGCTCGAGCTTTCATCCAAGGGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002145.3-197s21c1
Sequence:CCGGCCGCTGTCTTGGAGACATTTCCTCGAGGAAATGTCTCCAAGACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002145.2-1415s1c1
Sequence:CCGGCCAATGAAATCTCAGGAATAACTCGAGTTATTCCTGAGATTTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002145.2-428s1c1
Sequence:CCGGCCGCCAAGAAACCCAGCCAATCTCGAGATTGGCTGGGTTTCTTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002145.2-196s1c1
Sequence:CCGGCCCGCTGTCTTGGAGACATTTCTCGAGAAATGTCTCCAAGACAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002145.2-407s1c1
Sequence:CCGGCTTGGATGAAAGAGAAGAAATCTCGAGATTTCTTCTCTTTCATCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002145.2-901s1c1
Sequence:CCGGCGGCCTTTAGCCGTTCGCTTACTCGAGTAAGCGAACGGCTAAAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002145
VALIDATED
HOXB2 MISSION shRNA shRNA Plasmid DNA
homeobox B2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002145.3-1308s21c1
Sequence:CCGGTTACTGAATTAGCGTTTAATCCTCGAGGATTAAACGCTAATTCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002145.3-226s21c1
Sequence:CCGGTCAATCAAGGAGTCGACATTACTCGAGTAATGTCGACTCCTTGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002145.3-1128s21c1
Sequence:CCGGTTCCGAGGAAGAGCTGGATTTCTCGAGAAATCCAGCTCTTCCTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002145.3-398s21c1
Sequence:CCGGCCGAGTTCCCTTGGATGAAAGCTCGAGCTTTCATCCAAGGGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002145.3-197s21c1
Sequence:CCGGCCGCTGTCTTGGAGACATTTCCTCGAGGAAATGTCTCCAAGACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002145.2-1415s1c1
Sequence:CCGGCCAATGAAATCTCAGGAATAACTCGAGTTATTCCTGAGATTTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002145.2-428s1c1
Sequence:CCGGCCGCCAAGAAACCCAGCCAATCTCGAGATTGGCTGGGTTTCTTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002145.2-196s1c1
Sequence:CCGGCCCGCTGTCTTGGAGACATTTCTCGAGAAATGTCTCCAAGACAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002145.2-407s1c1
Sequence:CCGGCTTGGATGAAAGAGAAGAAATCTCGAGATTTCTTCTCTTTCATCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002145.2-901s1c1
Sequence:CCGGCGGCCTTTAGCCGTTCGCTTACTCGAGTAAGCGAACGGCTAAAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002145
VALIDATED
HOXB2 MISSION shRNA Lentiviral Transduction Particles
homeobox B2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002145.3-1308s21c1
Sequence:CCGGTTACTGAATTAGCGTTTAATCCTCGAGGATTAAACGCTAATTCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002145.3-226s21c1
Sequence:CCGGTCAATCAAGGAGTCGACATTACTCGAGTAATGTCGACTCCTTGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002145.3-1128s21c1
Sequence:CCGGTTCCGAGGAAGAGCTGGATTTCTCGAGAAATCCAGCTCTTCCTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002145.3-398s21c1
Sequence:CCGGCCGAGTTCCCTTGGATGAAAGCTCGAGCTTTCATCCAAGGGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002145.3-197s21c1
Sequence:CCGGCCGCTGTCTTGGAGACATTTCCTCGAGGAAATGTCTCCAAGACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002145.2-1415s1c1
Sequence:CCGGCCAATGAAATCTCAGGAATAACTCGAGTTATTCCTGAGATTTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002145.2-428s1c1
Sequence:CCGGCCGCCAAGAAACCCAGCCAATCTCGAGATTGGCTGGGTTTCTTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002145.2-196s1c1
Sequence:CCGGCCCGCTGTCTTGGAGACATTTCTCGAGAAATGTCTCCAAGACAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002145.2-407s1c1
Sequence:CCGGCTTGGATGAAAGAGAAGAAATCTCGAGATTTCTTCTCTTTCATCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002145.2-901s1c1
Sequence:CCGGCGGCCTTTAGCCGTTCGCTTACTCGAGTAAGCGAACGGCTAAAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks