EMAIL THIS PAGE TO A FRIEND

HOXB9

homeobox B9

Synonyms: HOX-2.5 HOX2 HOX2E
UniProtKB ID: P17482, B2RDB7, Q9H1I1
Gene ID:
Human(3219) Summary: This gene is a member of the Abd-B homeobox family and encodes a protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded nuclear protein functions as a sequence-specific transcription factor that is involved in cell proliferation and differentiation. Increased expression of this gene is associated with some cases of leukemia, prostate cancer and lung cancer. [provided by RefSeq, Jul 2008]
Mouse(15417) homeobox B9
Rat(287647) homeo box B9
chicken(771865) homeobox B9
dog(608958) homeobox B9
cow(783873) homeobox B9
sheep(101114883) homeobox B9
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501685 Anti-HOXB9 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, canine
ELISA, western blot pricing
SAB1405958 Anti-HOXB9 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1412481 ANTI-HOXB9 antibody produced in mouse clone 4C11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412482 ANTI-HOXB9 antibody produced in mouse clone 2E9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV32639 Anti-HOXB9 antibody produced in rabbit affinity isolated antibody rat, rabbit, human, bovine, canine, mouse, horse
immunohistochemistry, western blot pricing
HPA031463 Anti-HOXB9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2106241 Anti-HOXB9 antibody produced in rabbit affinity isolated antibody guinea pig, rat, rabbit, human, horse
ELISA, western blot pricing
SAB2106467 Anti-HOXB9 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, horse, human, rabbit
ELISA, western blot pricing
SAB2105264 Anti-HOXB9, (N-terminal) antibody produced in rabbit affinity isolated antibody horse, guinea pig, rabbit, mouse
western blot pricing
SAB4501433 Anti-HOXB9, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
WH0003219M1 Monoclonal Anti-HOXB9 antibody produced in mouse clone 3C8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403937 Monoclonal Anti-HOXB9 antibody produced in mouse clone 4C3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008270 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008270 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008270 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024017 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024017 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024017 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030671 MISSION® esiRNA esiRNA human HOXB9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024017 Rosetta Predictions human pricing
NM_001100497 Rosetta Predictions rat pricing
NM_008270 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185953 predicted 1190
2 SASI_Hs01_00185954 predicted 1288
3 SASI_Hs01_00185955 predicted 1232
4 SASI_Hs01_00185957 predicted 697
5 SASI_Hs01_00185958 predicted 1035
6 SASI_Hs01_00185959 predicted 1400
7 SASI_Hs01_00185960 predicted 927
8 SASI_Hs01_00185961 predicted 1238
9 SASI_Hs01_00185962 predicted 1126
10 SASI_Hs02_00356443 predicted 1092
11 SASI_Hs01_00185956 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209904 predicted 538
2 SASI_Rn02_00209905 predicted 391
3 SASI_Rn02_00209906 predicted 421
4 SASI_Rn02_00209907 predicted 398
5 SASI_Rn02_00209908 predicted 664
6 SASI_Rn02_00209909 predicted 382
7 SASI_Rn02_00209910 predicted 254
8 SASI_Rn02_00209911 predicted 396
9 SASI_Rn02_00209912 predicted 666
10 SASI_Rn02_00209913 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008270 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066317 predicted 1441
2 SASI_Mm01_00066318 predicted 1397
3 SASI_Mm01_00066319 predicted 1397
4 SASI_Mm01_00066320 predicted 1402
5 SASI_Mm02_00313507 predicted 705
6 SASI_Mm01_00066322 predicted 987
7 SASI_Mm01_00066323 predicted 1409
8 SASI_Mm01_00066324 predicted 1267
9 SASI_Mm01_00066325 predicted 1257
10 SASI_Mm01_00066321 predicted 1392
11 SASI_Mm01_00066326 predicted 761
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008270
HOXB9 MISSION shRNA Bacterial Glycerol Stock
homeobox B9
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008270.1-696s1c1
Sequence:CCGGCCTCAATCTGAGTGAGAGACACTCGAGTGTCTCTCACTCAGATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008270.1-472s1c1
Sequence:CCGGGTCCTGTCTAATCAAAGAGCTCTCGAGAGCTCTTTGATTAGACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008270.1-69s1c1
Sequence:CCGGCGACTCGATCATAAGTCACGACTCGAGTCGTGACTTATGATCGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008270.1-431s1c1
Sequence:CCGGCGCCCGAGTACAGTTTGGAAACTCGAGTTTCCAAACTGTACTCGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008270.1-759s1c1
Sequence:CCGGGATGAATAACGGAGCAGGCAACTCGAGTTGCCTGCTCCGTTATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008270.2-710s21c1
Sequence:CCGGCAAAGAGAGGCCGGATCAAACCTCGAGGTTTGATCCGGCCTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008270.2-948s21c1
Sequence:CCGGGAGCAGGGCAAAGAGTAAAGACTCGAGTCTTTACTCTTTGCCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008270
HOXB9 MISSION shRNA shRNA Plasmid DNA
homeobox B9
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008270.1-696s1c1
Sequence:CCGGCCTCAATCTGAGTGAGAGACACTCGAGTGTCTCTCACTCAGATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008270.1-472s1c1
Sequence:CCGGGTCCTGTCTAATCAAAGAGCTCTCGAGAGCTCTTTGATTAGACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008270.1-69s1c1
Sequence:CCGGCGACTCGATCATAAGTCACGACTCGAGTCGTGACTTATGATCGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008270.1-431s1c1
Sequence:CCGGCGCCCGAGTACAGTTTGGAAACTCGAGTTTCCAAACTGTACTCGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008270.1-759s1c1
Sequence:CCGGGATGAATAACGGAGCAGGCAACTCGAGTTGCCTGCTCCGTTATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008270.2-710s21c1
Sequence:CCGGCAAAGAGAGGCCGGATCAAACCTCGAGGTTTGATCCGGCCTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008270.2-948s21c1
Sequence:CCGGGAGCAGGGCAAAGAGTAAAGACTCGAGTCTTTACTCTTTGCCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008270
HOXB9 MISSION shRNA Lentiviral Transduction Particles
homeobox B9
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008270.1-696s1c1
Sequence:CCGGCCTCAATCTGAGTGAGAGACACTCGAGTGTCTCTCACTCAGATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008270.1-472s1c1
Sequence:CCGGGTCCTGTCTAATCAAAGAGCTCTCGAGAGCTCTTTGATTAGACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008270.1-69s1c1
Sequence:CCGGCGACTCGATCATAAGTCACGACTCGAGTCGTGACTTATGATCGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008270.1-431s1c1
Sequence:CCGGCGCCCGAGTACAGTTTGGAAACTCGAGTTTCCAAACTGTACTCGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008270.1-759s1c1
Sequence:CCGGGATGAATAACGGAGCAGGCAACTCGAGTTGCCTGCTCCGTTATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008270.2-710s21c1
Sequence:CCGGCAAAGAGAGGCCGGATCAAACCTCGAGGTTTGATCCGGCCTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008270.2-948s21c1
Sequence:CCGGGAGCAGGGCAAAGAGTAAAGACTCGAGTCTTTACTCTTTGCCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024017
VALIDATED
HOXB9 MISSION shRNA Bacterial Glycerol Stock
homeobox B9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024017.3-2312s1c1
Sequence:CCGGCCCTTCAATTTGTAGACTCTTCTCGAGAAGAGTCTACAAATTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024017.3-164s1c1
Sequence:CCGGCAAGTTTCCTTCTGGCCAGTACTCGAGTACTGGCCAGAAGGAAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024017.3-308s1c1
Sequence:CCGGGCCGTCCGTCTACCACCCTTACTCGAGTAAGGGTGGTAGACGGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024017.3-747s1c1
Sequence:CCGGCTCCTCAATCTGAGTGAGAGACTCGAGTCTCTCACTCAGATTGAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024017.3-487s1c1
Sequence:CCGGCCGAGTACAGTTTGGAAACTTCTCGAGAAGTTTCCAAACTGTACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024017.4-945s21c1
Sequence:CCGGGGGCAAAGAGTAAAGATTAAACTCGAGTTTAATCTTTACTCTTTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024017.4-639s21c1
Sequence:CCGGGGCCGTGCTGTCTAATCAAAGCTCGAGCTTTGATTAGACAGCACGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024017.4-702s21c1
Sequence:CCGGCAAAGAGAGGCCGGATCAAACCTCGAGGTTTGATCCGGCCTCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_024017.4-865s21c1
Sequence:CCGGCTCCTCAATCTGAGTGAGAGACTCGAGTCTCTCACTCAGATTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024017.4-2430s21c1
Sequence:CCGGCCCTTCAATTTGTAGACTCTTCTCGAGAAGAGTCTACAAATTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024017
VALIDATED
HOXB9 MISSION shRNA shRNA Plasmid DNA
homeobox B9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024017.3-2312s1c1
Sequence:CCGGCCCTTCAATTTGTAGACTCTTCTCGAGAAGAGTCTACAAATTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024017.3-164s1c1
Sequence:CCGGCAAGTTTCCTTCTGGCCAGTACTCGAGTACTGGCCAGAAGGAAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024017.3-308s1c1
Sequence:CCGGGCCGTCCGTCTACCACCCTTACTCGAGTAAGGGTGGTAGACGGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024017.3-747s1c1
Sequence:CCGGCTCCTCAATCTGAGTGAGAGACTCGAGTCTCTCACTCAGATTGAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024017.3-487s1c1
Sequence:CCGGCCGAGTACAGTTTGGAAACTTCTCGAGAAGTTTCCAAACTGTACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024017.4-945s21c1
Sequence:CCGGGGGCAAAGAGTAAAGATTAAACTCGAGTTTAATCTTTACTCTTTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024017.4-639s21c1
Sequence:CCGGGGCCGTGCTGTCTAATCAAAGCTCGAGCTTTGATTAGACAGCACGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024017.4-702s21c1
Sequence:CCGGCAAAGAGAGGCCGGATCAAACCTCGAGGTTTGATCCGGCCTCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_024017.4-865s21c1
Sequence:CCGGCTCCTCAATCTGAGTGAGAGACTCGAGTCTCTCACTCAGATTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024017.4-2430s21c1
Sequence:CCGGCCCTTCAATTTGTAGACTCTTCTCGAGAAGAGTCTACAAATTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024017
VALIDATED
HOXB9 MISSION shRNA Lentiviral Transduction Particles
homeobox B9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024017.3-2312s1c1
Sequence:CCGGCCCTTCAATTTGTAGACTCTTCTCGAGAAGAGTCTACAAATTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024017.3-164s1c1
Sequence:CCGGCAAGTTTCCTTCTGGCCAGTACTCGAGTACTGGCCAGAAGGAAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024017.3-308s1c1
Sequence:CCGGGCCGTCCGTCTACCACCCTTACTCGAGTAAGGGTGGTAGACGGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024017.3-747s1c1
Sequence:CCGGCTCCTCAATCTGAGTGAGAGACTCGAGTCTCTCACTCAGATTGAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024017.3-487s1c1
Sequence:CCGGCCGAGTACAGTTTGGAAACTTCTCGAGAAGTTTCCAAACTGTACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024017.4-945s21c1
Sequence:CCGGGGGCAAAGAGTAAAGATTAAACTCGAGTTTAATCTTTACTCTTTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024017.4-639s21c1
Sequence:CCGGGGCCGTGCTGTCTAATCAAAGCTCGAGCTTTGATTAGACAGCACGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024017.4-702s21c1
Sequence:CCGGCAAAGAGAGGCCGGATCAAACCTCGAGGTTTGATCCGGCCTCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_024017.4-865s21c1
Sequence:CCGGCTCCTCAATCTGAGTGAGAGACTCGAGTCTCTCACTCAGATTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024017.4-2430s21c1
Sequence:CCGGCCCTTCAATTTGTAGACTCTTCTCGAGAAGAGTCTACAAATTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks