EMAIL THIS PAGE TO A FRIEND

HOXD11

homeobox D11

Synonyms: HOX4 HOX4F
UniProtKB ID: P31277, A6NIS4, Q9NS02
Gene ID:
Human(3237) Summary: This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. The product of the mouse Hoxd11 gene plays a role in forelimb morphogenesis. [provided by RefSeq, Jul 2008]
Mouse(15431) homeobox D11
chicken(395328) homeobox D11
cow(613983) homeobox D11
dog(609973) homeobox D11
sheep(101104380) homeobox D11
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV31966 Anti-HOXD11 antibody produced in rabbit affinity isolated antibody human, bovine, mouse, rabbit, canine, sheep
western blot pricing
HPA055155 Anti-HOXD11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB1302577 ANTI-MOUSE HOXD11 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
WH0003237M1 Monoclonal Anti-HOXD11 antibody produced in mouse clone 5E7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409205 Monoclonal Anti-HOXD11 antibody produced in mouse clone 8C7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409206 Monoclonal Anti-HOXD11 antibody produced in mouse clone 8F10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409207 Monoclonal Anti-HOXD11 antibody produced in mouse clone 8B8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409208 Monoclonal Anti-HOXD11 antibody produced in mouse clone 6D8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409209 Monoclonal Anti-HOXD11 antibody produced in mouse clone 7F7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409210 Monoclonal Anti-HOXD11 antibody produced in mouse clone 7H2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409211 Monoclonal Anti-HOXD11 antibody produced in mouse clone 6E10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403944 Monoclonal Anti-HOXD11, (N-terminal) antibody produced in mouse clone 6C8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008273 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008273 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008273 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021192 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021192 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021192 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU170141 MISSION® esiRNA esiRNA targeting mouse Hoxd11 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021192 Rosetta Predictions human pricing
NM_008273 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077082 predicted 1191
2 SASI_Hs01_00077083 predicted 1090
3 SASI_Hs01_00077084 predicted 835
4 SASI_Hs01_00077085 predicted 1238
5 SASI_Hs01_00077086 predicted 905
6 SASI_Hs01_00077087 predicted 914
7 SASI_Hs01_00077088 predicted 911
8 SASI_Hs01_00077089 predicted 886
9 SASI_Hs01_00077090 predicted 1085
10 SASI_Hs01_00077091 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008273 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313510 predicted 108
2 SASI_Mm01_00131819 predicted 466
3 SASI_Mm01_00131820 predicted 966
4 SASI_Mm01_00131821 predicted 824
5 SASI_Mm01_00131822 predicted 902
6 SASI_Mm01_00131823 predicted 39
7 SASI_Mm01_00131824 predicted 391
8 SASI_Mm01_00131826 predicted 462
9 SASI_Mm01_00131827 predicted 461
10 SASI_Mm01_00131828 predicted 878
11 SASI_Mm01_00131825 predicted 106
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008273
HOXD11 MISSION shRNA Bacterial Glycerol Stock
homeobox D11
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008273.1-108s1c1
Sequence:CCGGGCAGCCGTCCTCGTGCCAGATCTCGAGATCTGGCACGAGGACGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008273.1-72s1c1
Sequence:CCGGCCCGTCGGACTTCGCCAGCAACTCGAGTTGCTGGCGAAGTCCGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008273.1-816s1c1
Sequence:CCGGCAAGTACCAGATCCGCGAACTCTCGAGAGTTCGCGGATCTGGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008273.1-470s1c1
Sequence:CCGGCCGCAGCCTCTAACTTCTACACTCGAGTGTAGAAGTTAGAGGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008273.1-408s1c1
Sequence:CCGGCGTGCTCTTCAAGGCTCCCGACTCGAGTCGGGAGCCTTGAAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008273.1-116s21c1
Sequence:CCGGCCTCGTGCCAGATGACTTTCCCTCGAGGGAAAGTCATCTGGCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008273.1-807s21c1
Sequence:CCGGTCCCTACACCAAGTACCAGATCTCGAGATCTGGTACTTGGTGTAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008273.1-478s21c1
Sequence:CCGGTCTAACTTCTACAGCGCCGTGCTCGAGCACGGCGCTGTAGAAGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008273.1-829s21c1
Sequence:CCGGCGCGAACTGGAACGCGAGTTTCTCGAGAAACTCGCGTTCCAGTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008273.1-518s21c1
Sequence:CCGGCCCAGGGCTTTGATCAGTTCTCTCGAGAGAACTGATCAAAGCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008273
HOXD11 MISSION shRNA shRNA Plasmid DNA
homeobox D11
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008273.1-108s1c1
Sequence:CCGGGCAGCCGTCCTCGTGCCAGATCTCGAGATCTGGCACGAGGACGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008273.1-72s1c1
Sequence:CCGGCCCGTCGGACTTCGCCAGCAACTCGAGTTGCTGGCGAAGTCCGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008273.1-816s1c1
Sequence:CCGGCAAGTACCAGATCCGCGAACTCTCGAGAGTTCGCGGATCTGGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008273.1-470s1c1
Sequence:CCGGCCGCAGCCTCTAACTTCTACACTCGAGTGTAGAAGTTAGAGGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008273.1-408s1c1
Sequence:CCGGCGTGCTCTTCAAGGCTCCCGACTCGAGTCGGGAGCCTTGAAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008273.1-116s21c1
Sequence:CCGGCCTCGTGCCAGATGACTTTCCCTCGAGGGAAAGTCATCTGGCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008273.1-807s21c1
Sequence:CCGGTCCCTACACCAAGTACCAGATCTCGAGATCTGGTACTTGGTGTAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008273.1-478s21c1
Sequence:CCGGTCTAACTTCTACAGCGCCGTGCTCGAGCACGGCGCTGTAGAAGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008273.1-829s21c1
Sequence:CCGGCGCGAACTGGAACGCGAGTTTCTCGAGAAACTCGCGTTCCAGTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008273.1-518s21c1
Sequence:CCGGCCCAGGGCTTTGATCAGTTCTCTCGAGAGAACTGATCAAAGCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008273
HOXD11 MISSION shRNA Lentiviral Transduction Particles
homeobox D11
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008273.1-108s1c1
Sequence:CCGGGCAGCCGTCCTCGTGCCAGATCTCGAGATCTGGCACGAGGACGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008273.1-72s1c1
Sequence:CCGGCCCGTCGGACTTCGCCAGCAACTCGAGTTGCTGGCGAAGTCCGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008273.1-816s1c1
Sequence:CCGGCAAGTACCAGATCCGCGAACTCTCGAGAGTTCGCGGATCTGGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008273.1-470s1c1
Sequence:CCGGCCGCAGCCTCTAACTTCTACACTCGAGTGTAGAAGTTAGAGGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008273.1-408s1c1
Sequence:CCGGCGTGCTCTTCAAGGCTCCCGACTCGAGTCGGGAGCCTTGAAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008273.1-116s21c1
Sequence:CCGGCCTCGTGCCAGATGACTTTCCCTCGAGGGAAAGTCATCTGGCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008273.1-807s21c1
Sequence:CCGGTCCCTACACCAAGTACCAGATCTCGAGATCTGGTACTTGGTGTAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008273.1-478s21c1
Sequence:CCGGTCTAACTTCTACAGCGCCGTGCTCGAGCACGGCGCTGTAGAAGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008273.1-829s21c1
Sequence:CCGGCGCGAACTGGAACGCGAGTTTCTCGAGAAACTCGCGTTCCAGTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008273.1-518s21c1
Sequence:CCGGCCCAGGGCTTTGATCAGTTCTCTCGAGAGAACTGATCAAAGCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021192
HOXD11 MISSION shRNA Bacterial Glycerol Stock
homeobox D11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021192.2-1089s1c1
Sequence:CCGGCCCACTGTCCTTGGGTTTAATCTCGAGATTAAACCCAAGGACAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021192.2-835s1c1
Sequence:CCGGCGCGAACTGGAACGCGAGTTTCTCGAGAAACTCGCGTTCCAGTTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021192.2-982s1c1
Sequence:CCGGCGTCTGCAGTATTTCACTGGACTCGAGTCCAGTGAAATACTGCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021192.2-367s1c1
Sequence:CCGGGCGGCCATGCAACGCGAGCTTCTCGAGAAGCTCGCGTTGCATGGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021192.2-72s1c1
Sequence:CCGGCCCGTCTGACTTCGCTAGCAACTCGAGTTGCTAGCGAAGTCAGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021192.2-1240s21c1
Sequence:CCGGGCAAACGTCCCGTTACAATTTCTCGAGAAATTGTAACGGGACGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021192.2-913s21c1
Sequence:CCGGCTCACTGACCGGCAAGTCAAACTCGAGTTTGACTTGCCGGTCAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021192.2-115s21c1
Sequence:CCGGTCGTCCTGCCAGATGACTTTCCTCGAGGAAAGTCATCTGGCAGGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021192.2-1120s21c1
Sequence:CCGGCTCTGTGGAACTTCACGATTCCTCGAGGAATCGTGAAGTTCCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021192
HOXD11 MISSION shRNA shRNA Plasmid DNA
homeobox D11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021192.2-1089s1c1
Sequence:CCGGCCCACTGTCCTTGGGTTTAATCTCGAGATTAAACCCAAGGACAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021192.2-835s1c1
Sequence:CCGGCGCGAACTGGAACGCGAGTTTCTCGAGAAACTCGCGTTCCAGTTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021192.2-982s1c1
Sequence:CCGGCGTCTGCAGTATTTCACTGGACTCGAGTCCAGTGAAATACTGCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021192.2-367s1c1
Sequence:CCGGGCGGCCATGCAACGCGAGCTTCTCGAGAAGCTCGCGTTGCATGGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021192.2-72s1c1
Sequence:CCGGCCCGTCTGACTTCGCTAGCAACTCGAGTTGCTAGCGAAGTCAGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021192.2-1240s21c1
Sequence:CCGGGCAAACGTCCCGTTACAATTTCTCGAGAAATTGTAACGGGACGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021192.2-913s21c1
Sequence:CCGGCTCACTGACCGGCAAGTCAAACTCGAGTTTGACTTGCCGGTCAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021192.2-115s21c1
Sequence:CCGGTCGTCCTGCCAGATGACTTTCCTCGAGGAAAGTCATCTGGCAGGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021192.2-1120s21c1
Sequence:CCGGCTCTGTGGAACTTCACGATTCCTCGAGGAATCGTGAAGTTCCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021192
HOXD11 MISSION shRNA Lentiviral Transduction Particles
homeobox D11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021192.2-1089s1c1
Sequence:CCGGCCCACTGTCCTTGGGTTTAATCTCGAGATTAAACCCAAGGACAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021192.2-835s1c1
Sequence:CCGGCGCGAACTGGAACGCGAGTTTCTCGAGAAACTCGCGTTCCAGTTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021192.2-982s1c1
Sequence:CCGGCGTCTGCAGTATTTCACTGGACTCGAGTCCAGTGAAATACTGCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021192.2-367s1c1
Sequence:CCGGGCGGCCATGCAACGCGAGCTTCTCGAGAAGCTCGCGTTGCATGGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021192.2-72s1c1
Sequence:CCGGCCCGTCTGACTTCGCTAGCAACTCGAGTTGCTAGCGAAGTCAGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021192.2-1240s21c1
Sequence:CCGGGCAAACGTCCCGTTACAATTTCTCGAGAAATTGTAACGGGACGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021192.2-913s21c1
Sequence:CCGGCTCACTGACCGGCAAGTCAAACTCGAGTTTGACTTGCCGGTCAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021192.2-115s21c1
Sequence:CCGGTCGTCCTGCCAGATGACTTTCCTCGAGGAAAGTCATCTGGCAGGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021192.2-1120s21c1
Sequence:CCGGCTCTGTGGAACTTCACGATTCCTCGAGGAATCGTGAAGTTCCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks