EMAIL THIS PAGE TO A FRIEND

HOXD1

homeobox D1

Synonyms: HOX4 HOX4G Hox-4.7
UniProtKB ID: Q9GZZ0, B2RAB4
Gene ID:
Human(3231) Summary: This gene is a member of the Antp homeobox family and encodes a protein with a homeobox DNA-binding domain. This nuclear protein functions as a sequence-specific transcription factor that is involved in differentiation and limb development. Mutations in this gene have been associated with severe developmental defects on the anterior-posterior (a-p) limb axis. [provided by RefSeq, Jul 2008]
Mouse(15429) homeobox D1
Rat(288151) homeo box D1
chicken(771094) homeobox D1
cow(100295780) homeobox D1
dog(609999) homeobox D1
chicken(101750316) homeobox D1
chicken(101666736) homeobox D1
sheep(101106056) homeobox D1
152 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010467 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010467 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010467 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024501 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024501 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024501 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001681 MISSION® esiRNA esiRNA targeting human HOXD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024501 Rosetta Predictions human pricing
NM_001105884 Rosetta Predictions rat pricing
NM_010467 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356769 predicted 1090
2 SASI_Hs01_00223125 predicted 1401
3 SASI_Hs01_00223126 predicted 1405
4 SASI_Hs01_00223127 predicted 1417
5 SASI_Hs01_00223128 predicted 1327
6 SASI_Hs01_00223129 predicted 1020
7 SASI_Hs02_00356770 predicted 1017
8 SASI_Hs01_00223130 predicted 1373
9 SASI_Hs01_00223131 predicted 926
10 SASI_Hs01_00223132 predicted 830
11 SASI_Hs01_00223133 predicted 926
12 SASI_Hs01_00223134 predicted 1198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105884 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213482 predicted 1104
2 SASI_Rn02_00213483 predicted 1255
3 SASI_Rn02_00213484 predicted 1147
4 SASI_Rn02_00213485 predicted 1342
5 SASI_Rn02_00213486 predicted 1010
6 SASI_Rn02_00213487 predicted 1271
7 SASI_Rn02_00213488 predicted 905
8 SASI_Rn02_00213489 predicted 1033
9 SASI_Rn02_00213490 predicted 878
10 SASI_Rn02_00213491 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010467 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318656 predicted 1204
2 SASI_Mm02_00318657 predicted 847
3 SASI_Mm02_00318658 predicted 1367
4 SASI_Mm01_00111683 predicted 925
5 SASI_Mm01_00111687 predicted 1154
6 SASI_Mm01_00111688 predicted 1048
7 SASI_Mm02_00318659 predicted 907
8 SASI_Mm02_00318660 predicted 1161
9 SASI_Mm02_00318661 predicted 900
10 SASI_Mm02_00318662 predicted 1035
11 SASI_Mm01_00111680 predicted 776
12 SASI_Mm01_00111681 predicted 730
13 SASI_Mm01_00111682 predicted 860
14 SASI_Mm01_00111684 predicted 1285
15 SASI_Mm01_00111685 predicted 1289
16 SASI_Mm01_00111686 predicted 862
17 SASI_Mm01_00111689 predicted 728
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010467
HOXD1 MISSION shRNA Bacterial Glycerol Stock
homeobox D1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010467.1-895s1c1
Sequence:CCGGGCATCGAGATAGCCAACTGTTCTCGAGAACAGTTGGCTATCTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010467.1-1037s1c1
Sequence:CCGGGTCAGAAACAAGTCCCATCAACTCGAGTTGATGGGACTTGTTTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010467.1-906s1c1
Sequence:CCGGGCCAACTGTTTACAGCTGAATCTCGAGATTCAGCTGTAAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010467.1-815s1c1
Sequence:CCGGCCGCACAAATTTCAGCACCAACTCGAGTTGGTGCTGAAATTTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010467.1-956s1c1
Sequence:CCGGCCGTAGGATGAAGCAGAAGAACTCGAGTTCTTCTGCTTCATCCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010467
HOXD1 MISSION shRNA shRNA Plasmid DNA
homeobox D1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010467.1-895s1c1
Sequence:CCGGGCATCGAGATAGCCAACTGTTCTCGAGAACAGTTGGCTATCTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010467.1-1037s1c1
Sequence:CCGGGTCAGAAACAAGTCCCATCAACTCGAGTTGATGGGACTTGTTTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010467.1-906s1c1
Sequence:CCGGGCCAACTGTTTACAGCTGAATCTCGAGATTCAGCTGTAAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010467.1-815s1c1
Sequence:CCGGCCGCACAAATTTCAGCACCAACTCGAGTTGGTGCTGAAATTTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010467.1-956s1c1
Sequence:CCGGCCGTAGGATGAAGCAGAAGAACTCGAGTTCTTCTGCTTCATCCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010467
HOXD1 MISSION shRNA Lentiviral Transduction Particles
homeobox D1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010467.1-895s1c1
Sequence:CCGGGCATCGAGATAGCCAACTGTTCTCGAGAACAGTTGGCTATCTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010467.1-1037s1c1
Sequence:CCGGGTCAGAAACAAGTCCCATCAACTCGAGTTGATGGGACTTGTTTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010467.1-906s1c1
Sequence:CCGGGCCAACTGTTTACAGCTGAATCTCGAGATTCAGCTGTAAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010467.1-815s1c1
Sequence:CCGGCCGCACAAATTTCAGCACCAACTCGAGTTGGTGCTGAAATTTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010467.1-956s1c1
Sequence:CCGGCCGTAGGATGAAGCAGAAGAACTCGAGTTCTTCTGCTTCATCCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024501
HOXD1 MISSION shRNA Bacterial Glycerol Stock
homeobox D1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024501.1-1024s1c1
Sequence:CCGGCCTGAATGACACGCAAGTCAACTCGAGTTGACTTGCGTGTCATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024501.1-871s1c1
Sequence:CCGGGAAAGGTAAACTCGCCGAGTACTCGAGTACTCGGCGAGTTTACCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024501.1-830s1c1
Sequence:CCGGAGCACGTTCGAGTGGATGAAACTCGAGTTTCATCCACTCGAACGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024501.1-1000s1c1
Sequence:CCGGCATCGAGATAGCCAACTGCTTCTCGAGAAGCAGTTGGCTATCTCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024501.1-1409s21c1
Sequence:CCGGCCACTTGTTTGGTTATGATTTCTCGAGAAATCATAACCAAACAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024501
HOXD1 MISSION shRNA shRNA Plasmid DNA
homeobox D1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024501.1-1024s1c1
Sequence:CCGGCCTGAATGACACGCAAGTCAACTCGAGTTGACTTGCGTGTCATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024501.1-871s1c1
Sequence:CCGGGAAAGGTAAACTCGCCGAGTACTCGAGTACTCGGCGAGTTTACCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024501.1-830s1c1
Sequence:CCGGAGCACGTTCGAGTGGATGAAACTCGAGTTTCATCCACTCGAACGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024501.1-1000s1c1
Sequence:CCGGCATCGAGATAGCCAACTGCTTCTCGAGAAGCAGTTGGCTATCTCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024501.1-1409s21c1
Sequence:CCGGCCACTTGTTTGGTTATGATTTCTCGAGAAATCATAACCAAACAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024501
HOXD1 MISSION shRNA Lentiviral Transduction Particles
homeobox D1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024501.1-1024s1c1
Sequence:CCGGCCTGAATGACACGCAAGTCAACTCGAGTTGACTTGCGTGTCATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024501.1-871s1c1
Sequence:CCGGGAAAGGTAAACTCGCCGAGTACTCGAGTACTCGGCGAGTTTACCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024501.1-830s1c1
Sequence:CCGGAGCACGTTCGAGTGGATGAAACTCGAGTTTCATCCACTCGAACGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024501.1-1000s1c1
Sequence:CCGGCATCGAGATAGCCAACTGCTTCTCGAGAAGCAGTTGGCTATCTCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024501.1-1409s21c1
Sequence:CCGGCCACTTGTTTGGTTATGATTTCTCGAGAAATCATAACCAAACAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks