EMAIL THIS PAGE TO A FRIEND

HPGD

hydroxyprostaglandin dehydrogenase 15-(NAD)

Synonyms: 15-PGDH PGDH PGDH1 PHOAR1 SDR36C1
Gene ID:
Human(3248) Summary: This gene encodes a member of the short-chain nonmetalloenzyme alcohol dehydrogenase protein family. The encoded enzyme is responsible for the metabolism of prostaglandins, which function in a variety of physiologic and cellular processes such as inflammation. Mutations in this gene result in primary autosomal recessive hypertrophic osteoarthropathy and cranioosteoarthropathy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(15446) hydroxyprostaglandin dehydrogenase 15 (NAD)
Rat(79242) hydroxyprostaglandin dehydrogenase 15 (NAD)
chicken(422567) hydroxyprostaglandin dehydrogenase 15-(NAD)
cow(512259) hydroxyprostaglandin dehydrogenase 15-(NAD)
domestic cat(101087832) hydroxyprostaglandin dehydrogenase 15-(NAD)
Horse(100009687) hydroxyprostaglandin dehydrogenase 15-(NAD)
dog(486073) hydroxyprostaglandin dehydrogenase 15-(NAD)
sheep(101112958) hydroxyprostaglandin dehydrogenase 15-(NAD)
domestic guinea pig(100135538) hydroxyprostaglandin dehydrogenase 15 (NAD)
naked mole-rat(101714528) hydroxyprostaglandin dehydrogenase 15-(NAD)
Gene Class: Dehydrogenase
187 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1238 Human 15-PGDH ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000860 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000860 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000860 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008278 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008278 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008278 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072531 MISSION® esiRNA esiRNA human HPGD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000860 Rosetta Predictions human pricing
NM_024390 Rosetta Predictions rat pricing
NM_008278 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167992 predicted 803
2 SASI_Hs01_00167993 predicted 732
3 SASI_Hs01_00167994 predicted 207
4 SASI_Hs01_00167996 predicted 571
5 SASI_Hs01_00167997 predicted 348
6 SASI_Hs01_00167998 predicted 812
7 SASI_Hs02_00303378 predicted 270
8 SASI_Hs01_00167999 predicted 739
9 SASI_Hs01_00168000 predicted 315
10 SASI_Hs01_00168001 predicted 734
11 SASI_Hs01_00167995 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024390 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061513 predicted 203
2 SASI_Rn01_00061514 predicted 1103
3 SASI_Rn01_00061515 predicted 1020
4 SASI_Rn02_00263988 predicted 460
5 SASI_Rn01_00061516 predicted 725
6 SASI_Rn01_00061517 predicted 585
7 SASI_Rn01_00061518 predicted 331
8 SASI_Rn01_00061520 predicted 947
9 SASI_Rn01_00061521 predicted 844
10 SASI_Rn01_00061522 predicted 319
11 SASI_Rn01_00061519 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313536 predicted 860
2 SASI_Mm01_00073673 predicted 582
3 SASI_Mm01_00073676 predicted 970
4 SASI_Mm02_00313537 predicted 208
5 SASI_Mm02_00313538 predicted 771
6 SASI_Mm01_00073674 predicted 402
7 SASI_Mm01_00073678 predicted 938
8 SASI_Mm02_00313539 predicted 728
9 SASI_Mm01_00073679 predicted 301
10 SASI_Mm01_00073680 predicted 374
11 SASI_Mm01_00073671 predicted 331
12 SASI_Mm01_00073672 predicted 626
13 SASI_Mm01_00073675 predicted 474
14 SASI_Mm01_00073677 predicted 741
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000860
HPGD MISSION shRNA Bacterial Glycerol Stock
hydroxyprostaglandin dehydrogenase 15-(NAD)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000860.x-579s1c1
Sequence:CCGGCACAGCCATCCTTGAATCAATCTCGAGATTGATTCAAGGATGGCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000860.x-1794s1c1
Sequence:CCGGACTCATAACAACACAGACATACTCGAGTATGTCTGTGTTGTTATGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000860.x-222s1c1
Sequence:CCGGGCAACAACTGAGAGACACTTTCTCGAGAAAGTGTCTCTCAGTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000860.x-292s1c1
Sequence:CCGGGCTGGAGTGAATAATGAGAAACTCGAGTTTCTCATTATTCACTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000860.4-898s21c1
Sequence:CCGGTGCTTTAAATGGTGCTATTATCTCGAGATAATAGCACCATTTAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000860.4-1186s21c1
Sequence:CCGGGACCAAAGGCTAGGTTGTAATCTCGAGATTACAACCTAGCCTTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000860.4-685s21c1
Sequence:CCGGAGCGTTGGCTGCTAATCTTATCTCGAGATAAGATTAGCAGCCAACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000860.4-953s21c1
Sequence:CCGGGACTATGATACAACTCCATTTCTCGAGAAATGGAGTTGTATCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000860
HPGD MISSION shRNA shRNA Plasmid DNA
hydroxyprostaglandin dehydrogenase 15-(NAD)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000860.x-579s1c1
Sequence:CCGGCACAGCCATCCTTGAATCAATCTCGAGATTGATTCAAGGATGGCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000860.x-1794s1c1
Sequence:CCGGACTCATAACAACACAGACATACTCGAGTATGTCTGTGTTGTTATGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000860.x-222s1c1
Sequence:CCGGGCAACAACTGAGAGACACTTTCTCGAGAAAGTGTCTCTCAGTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000860.x-292s1c1
Sequence:CCGGGCTGGAGTGAATAATGAGAAACTCGAGTTTCTCATTATTCACTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000860.4-898s21c1
Sequence:CCGGTGCTTTAAATGGTGCTATTATCTCGAGATAATAGCACCATTTAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000860.4-1186s21c1
Sequence:CCGGGACCAAAGGCTAGGTTGTAATCTCGAGATTACAACCTAGCCTTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000860.4-685s21c1
Sequence:CCGGAGCGTTGGCTGCTAATCTTATCTCGAGATAAGATTAGCAGCCAACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000860.4-953s21c1
Sequence:CCGGGACTATGATACAACTCCATTTCTCGAGAAATGGAGTTGTATCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000860
HPGD MISSION shRNA Lentiviral Transduction Particles
hydroxyprostaglandin dehydrogenase 15-(NAD)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000860.x-579s1c1
Sequence:CCGGCACAGCCATCCTTGAATCAATCTCGAGATTGATTCAAGGATGGCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000860.x-1794s1c1
Sequence:CCGGACTCATAACAACACAGACATACTCGAGTATGTCTGTGTTGTTATGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000860.x-222s1c1
Sequence:CCGGGCAACAACTGAGAGACACTTTCTCGAGAAAGTGTCTCTCAGTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000860.x-292s1c1
Sequence:CCGGGCTGGAGTGAATAATGAGAAACTCGAGTTTCTCATTATTCACTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000860.4-898s21c1
Sequence:CCGGTGCTTTAAATGGTGCTATTATCTCGAGATAATAGCACCATTTAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000860.4-1186s21c1
Sequence:CCGGGACCAAAGGCTAGGTTGTAATCTCGAGATTACAACCTAGCCTTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000860.4-685s21c1
Sequence:CCGGAGCGTTGGCTGCTAATCTTATCTCGAGATAAGATTAGCAGCCAACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000860.4-953s21c1
Sequence:CCGGGACTATGATACAACTCCATTTCTCGAGAAATGGAGTTGTATCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008278
VALIDATED
HPGD MISSION shRNA Bacterial Glycerol Stock
hydroxyprostaglandin dehydrogenase 15-(NAD)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008278.1-301s1c1
Sequence:CCGGGCAGGCGTGAACAATGAGAAACTCGAGTTTCTCATTGTTCACGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008278.1-592s1c1
Sequence:CCGGCCCATCCTTGAATCCATTGAACTCGAGTTCAATGGATTCAAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008278.1-116s1c1
Sequence:CCGGCCAAGGTAGCATTGGTGGATTCTCGAGAATCCACCAATGCTACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008278.1-464s1c1
Sequence:CCGGCGCAGCAACCTGTTTATTGTTCTCGAGAACAATAAACAGGTTGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008278.1-764s1c1
Sequence:CCGGCGGCATCGGAAGGAATTCATTCTCGAGAATGAATTCCTTCCGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008278
VALIDATED
HPGD MISSION shRNA shRNA Plasmid DNA
hydroxyprostaglandin dehydrogenase 15-(NAD)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008278.1-301s1c1
Sequence:CCGGGCAGGCGTGAACAATGAGAAACTCGAGTTTCTCATTGTTCACGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008278.1-592s1c1
Sequence:CCGGCCCATCCTTGAATCCATTGAACTCGAGTTCAATGGATTCAAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008278.1-116s1c1
Sequence:CCGGCCAAGGTAGCATTGGTGGATTCTCGAGAATCCACCAATGCTACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008278.1-464s1c1
Sequence:CCGGCGCAGCAACCTGTTTATTGTTCTCGAGAACAATAAACAGGTTGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008278.1-764s1c1
Sequence:CCGGCGGCATCGGAAGGAATTCATTCTCGAGAATGAATTCCTTCCGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008278
VALIDATED
HPGD MISSION shRNA Lentiviral Transduction Particles
hydroxyprostaglandin dehydrogenase 15-(NAD)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008278.1-301s1c1
Sequence:CCGGGCAGGCGTGAACAATGAGAAACTCGAGTTTCTCATTGTTCACGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008278.1-592s1c1
Sequence:CCGGCCCATCCTTGAATCCATTGAACTCGAGTTCAATGGATTCAAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008278.1-116s1c1
Sequence:CCGGCCAAGGTAGCATTGGTGGATTCTCGAGAATCCACCAATGCTACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008278.1-464s1c1
Sequence:CCGGCGCAGCAACCTGTTTATTGTTCTCGAGAACAATAAACAGGTTGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008278.1-764s1c1
Sequence:CCGGCGGCATCGGAAGGAATTCATTCTCGAGAATGAATTCCTTCCGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks